ID: 947596069

View in Genome Browser
Species Human (GRCh38)
Location 2:231412452-231412474
Sequence CCCCGCGAGGAGCAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947596051_947596069 17 Left 947596051 2:231412412-231412434 CCTCCCAGTGCCGGCTGCAGGGC No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596052_947596069 14 Left 947596052 2:231412415-231412437 CCCAGTGCCGGCTGCAGGGCCGC No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596056_947596069 7 Left 947596056 2:231412422-231412444 CCGGCTGCAGGGCCGCGGGTCGG No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596063_947596069 -5 Left 947596063 2:231412434-231412456 CCGCGGGTCGGGGCGGGGCCCCG No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data
947596053_947596069 13 Left 947596053 2:231412416-231412438 CCAGTGCCGGCTGCAGGGCCGCG No data
Right 947596069 2:231412452-231412474 CCCCGCGAGGAGCAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947596069 Original CRISPR CCCCGCGAGGAGCAAGGGGC TGG Intergenic
No off target data available for this crispr