ID: 947601857

View in Genome Browser
Species Human (GRCh38)
Location 2:231456341-231456363
Sequence CACTTTCCATAGAAGATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947601857_947601872 20 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601872 2:231456384-231456406 TGGGGCCCAGTGGATGGGGCAGG 0: 1
1: 0
2: 8
3: 63
4: 606
947601857_947601870 15 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601870 2:231456379-231456401 GCAGGTGGGGCCCAGTGGATGGG 0: 1
1: 1
2: 4
3: 34
4: 271
947601857_947601865 2 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601865 2:231456366-231456388 AGAAGCAACCCAAGCAGGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 242
947601857_947601863 0 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601863 2:231456364-231456386 GGAGAAGCAACCCAAGCAGGTGG 0: 1
1: 0
2: 2
3: 30
4: 299
947601857_947601875 29 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601875 2:231456393-231456415 GTGGATGGGGCAGGAAATCATGG 0: 1
1: 0
2: 0
3: 33
4: 375
947601857_947601862 -3 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601862 2:231456361-231456383 GTGGGAGAAGCAACCCAAGCAGG 0: 1
1: 0
2: 3
3: 20
4: 200
947601857_947601869 14 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601869 2:231456378-231456400 AGCAGGTGGGGCCCAGTGGATGG 0: 1
1: 0
2: 12
3: 146
4: 1223
947601857_947601871 16 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601871 2:231456380-231456402 CAGGTGGGGCCCAGTGGATGGGG 0: 1
1: 0
2: 4
3: 43
4: 394
947601857_947601864 1 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601864 2:231456365-231456387 GAGAAGCAACCCAAGCAGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 196
947601857_947601867 10 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601867 2:231456374-231456396 CCCAAGCAGGTGGGGCCCAGTGG 0: 1
1: 1
2: 1
3: 47
4: 377
947601857_947601876 30 Left 947601857 2:231456341-231456363 CCCCAGATCTTCTATGGAAAGTG 0: 1
1: 0
2: 0
3: 12
4: 165
Right 947601876 2:231456394-231456416 TGGATGGGGCAGGAAATCATGGG 0: 1
1: 0
2: 2
3: 27
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947601857 Original CRISPR CACTTTCCATAGAAGATCTG GGG (reversed) Intronic
901330873 1:8407520-8407542 CACTTGCAACAGAAGCTCTGTGG + Intronic
905021158 1:34813311-34813333 CACTTTTCACTGTAGATCTGTGG - Intronic
905241140 1:36582338-36582360 CACTTTCCACAGAAGCAGTGGGG - Intergenic
905329836 1:37186839-37186861 TACTTTCCCTAGAAGAGCTAAGG + Intergenic
906573044 1:46861525-46861547 CACTTTGAATAGATGATCTAAGG + Intergenic
907639153 1:56168239-56168261 CTCTTTCCATAAAAGATTTGAGG + Intergenic
908160319 1:61401616-61401638 CACTTTCCATTGAGCACCTGAGG + Intronic
908186448 1:61657094-61657116 CACTTTACAGAGAACATCTCTGG - Intergenic
909159155 1:72123138-72123160 CAATTAAAATAGAAGATCTGAGG - Intronic
909738399 1:78996496-78996518 CACATTCCATAGAAGATAAGTGG + Intronic
910469374 1:87535091-87535113 CATTTTCCTTAAAAGATCTCTGG - Intergenic
911725356 1:101236763-101236785 CACTGTCCAGGAAAGATCTGGGG - Intergenic
912187204 1:107292573-107292595 CACTTTCCCAATAAGATCTCGGG + Intronic
914239378 1:145842432-145842454 CATCTTCCTCAGAAGATCTGGGG + Exonic
914389711 1:147208936-147208958 CATTTTATATGGAAGATCTGTGG - Exonic
916491759 1:165308285-165308307 CACCTTCCATACAAGCTTTGTGG + Intronic
918367387 1:183822781-183822803 CACTTATCATAGTAGATTTGAGG + Intronic
921183497 1:212650734-212650756 CACTTTCCACCAAAGATTTGGGG - Intergenic
921292721 1:213673571-213673593 CACTATCTATAGAAATTCTGAGG + Intergenic
921333669 1:214065033-214065055 CACTTTCTATGCAGGATCTGTGG + Intergenic
921769507 1:219019537-219019559 CATTTTTGATAGAAGTTCTGAGG - Intergenic
922396190 1:225203081-225203103 CACTTTCTTTAGAGGGTCTGTGG + Intronic
922963471 1:229667656-229667678 CTCTGTCAATAGAAGAACTGGGG + Intergenic
923018246 1:230143291-230143313 CACCTTCCAGAGAAGCTCTCAGG - Intronic
1063003948 10:1951089-1951111 CACATTCCAGAGAAAATCAGAGG + Intergenic
1063515240 10:6688733-6688755 CCCTTTCCAGAGGAGACCTGAGG + Intergenic
1063730481 10:8691327-8691349 AACTTTCTATAGAAACTCTGTGG + Intergenic
1064438844 10:15334722-15334744 AACCTGCCTTAGAAGATCTGGGG - Intronic
1065151040 10:22823878-22823900 AGCTTTCCCTAGAAAATCTGAGG + Intergenic
1065925577 10:30432182-30432204 CATTTTCCATAGCAGAAATGTGG + Intergenic
1068263482 10:54616309-54616331 AATTTTCCATAGAAAATCTAAGG - Intronic
1069316697 10:67113369-67113391 CAATTTACATATAAGATGTGTGG + Intronic
1070947191 10:80402495-80402517 CACTTTTAATAGAATATCTGAGG + Intergenic
1071561720 10:86650846-86650868 CACTATCCATAGATGCTCCGAGG + Intergenic
1071729324 10:88232269-88232291 CACCCTCCAAAGAAGGTCTGAGG + Intergenic
1074416164 10:113268758-113268780 CAGTATCCATAGAAGCTGTGTGG + Intergenic
1075092712 10:119452539-119452561 CACTACCCATAGCAGTTCTGGGG + Intronic
1075892515 10:125965484-125965506 GCATTTCCATAGAAGATCTCAGG + Intronic
1076162005 10:128251627-128251649 AACCTTGCATAGAAGATCTGAGG + Intergenic
1076476427 10:130756869-130756891 CACTGGCCAGAGAAGACCTGTGG - Intergenic
1077609934 11:3637833-3637855 CTCTGTCCATAAAAGATCTGAGG - Intergenic
1082975681 11:59069354-59069376 CACTTCCCAAAGAAGATATGTGG - Intergenic
1083112484 11:60424897-60424919 TATTTTCCAGAGAAGATCTCTGG - Intergenic
1084471076 11:69359204-69359226 TACTTTCCAAAGCAGCTCTGGGG + Intronic
1084794498 11:71496127-71496149 CACCTTCCATGGATGATTTGTGG + Intronic
1084845811 11:71899033-71899055 GAGTGTCCATAGAAGATTTGGGG - Intronic
1085878662 11:80439454-80439476 CACTTTGCAGAGAGAATCTGAGG + Intergenic
1089645015 11:119873333-119873355 CACTTTCCAGAGAAGTTGGGTGG - Intergenic
1090416585 11:126544561-126544583 GACTTTCCATAGAGGGTCTTTGG + Intronic
1091027008 11:132150333-132150355 AACTTTCCACATAAGATCTACGG + Intronic
1091092089 11:132781008-132781030 CCCTTTCCATAAAGGATTTGAGG + Intronic
1092854940 12:12664617-12664639 CACTTTCCATATAAGAAATCAGG + Intronic
1093334459 12:17885460-17885482 CACTTTCCATTTGAGATCCGTGG - Intergenic
1094132248 12:27086733-27086755 CACTTCCAAAAGAAGATCAGGGG + Intergenic
1094773262 12:33690865-33690887 AATTTTCCTTAGAAGATCTCAGG - Intergenic
1099339010 12:81403593-81403615 CAGTTTCCAGATAAGATCTCAGG + Intronic
1101048178 12:100832725-100832747 CACTTTCCTCTCAAGATCTGTGG + Intronic
1103237010 12:119381837-119381859 AACTTTCCATTGTAGATCTTAGG - Intronic
1104649035 12:130517794-130517816 CACTGTCCACAGACCATCTGGGG - Intronic
1105757176 13:23477751-23477773 AACTTCCCAAAGAAAATCTGAGG - Intergenic
1105930792 13:25049646-25049668 CACTTTCCAGAGAGCATCAGTGG - Intergenic
1107639051 13:42422403-42422425 CACTTTACAGAGAAGTTATGAGG + Intergenic
1107864500 13:44690594-44690616 CATTTTCCAGAGAAGATGGGTGG + Intergenic
1108108988 13:47047182-47047204 GATTTTCCCTAGAAGATGTGAGG + Intergenic
1111151633 13:84261481-84261503 CATTTTCCAGGGAAGCTCTGGGG - Intergenic
1111243276 13:85503436-85503458 CAGTTTCCCTATAAGATCTCAGG - Intergenic
1114768097 14:25397681-25397703 AACTTTCCAGAGAATAACTGTGG - Intergenic
1116173266 14:41430195-41430217 CACTTTCCAGATAAGATCTCAGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1119025495 14:71149117-71149139 GCCTTTCCAGAGAAGAACTGAGG - Intergenic
1119326973 14:73765858-73765880 AACTTTACAAAGTAGATCTGGGG - Intronic
1122405580 14:101498845-101498867 ATCTTTCCATGCAAGATCTGTGG + Intergenic
1126734062 15:51714017-51714039 AACTTTCCAGAGAAGACTTGTGG - Intronic
1127837199 15:62799453-62799475 CACTTTGAAAAGATGATCTGTGG + Intronic
1128224328 15:65991340-65991362 CTCATTCCAAAGAGGATCTGAGG + Intronic
1128859515 15:71054603-71054625 CTCTTTCCATAAAGGATTTGAGG - Intergenic
1130901489 15:88210002-88210024 CACTGTCCACATAGGATCTGGGG + Intronic
1132925493 16:2427236-2427258 CACTTCCCAGAGAGGAGCTGAGG - Intergenic
1140193891 16:72840882-72840904 CACTTTCCAAACCAAATCTGGGG + Intronic
1140287878 16:73621779-73621801 CATTTTTAATGGAAGATCTGGGG - Intergenic
1140637539 16:76933319-76933341 TTCTTTCCATTAAAGATCTGAGG + Intergenic
1203144215 16_KI270728v1_random:1789513-1789535 CATTATTCATAGAAGAGCTGTGG - Intergenic
1146543326 17:33717003-33717025 AACTTTCTAAAGAAGATCTGTGG + Intronic
1146737230 17:35248931-35248953 CTCTTTCCATAGTAAATCCGAGG + Intronic
1159442911 18:68504750-68504772 CTCTCTCAACAGAAGATCTGTGG - Intergenic
1159997045 18:74975596-74975618 CACTTTCCATACTAGGTCTAGGG + Intronic
1160063584 18:75553571-75553593 CACTTTCAATAAAGGATCTTGGG + Intergenic
1164332682 19:24275041-24275063 CTCTTTCCATATTATATCTGGGG + Intergenic
1164395661 19:27861014-27861036 CTCTTTCTTTAGAAGACCTGAGG - Intergenic
1165665102 19:37621539-37621561 CACTTTGAATAGATCATCTGAGG + Intronic
1165971657 19:39636958-39636980 CTCTTTCCCAAGAAGATTTGTGG - Intergenic
1167173742 19:47851148-47851170 CATTTTCCAGAGAAAACCTGAGG + Intergenic
925013946 2:507736-507758 ATCTTTCCAAAGAAGATCTTTGG + Intergenic
926237325 2:11055370-11055392 ACCTTTCCATAGGAAATCTGAGG + Intergenic
932348419 2:71011696-71011718 GAGTGTCCATAGAAGATTTGGGG - Intergenic
932351304 2:71034565-71034587 GAGTGTCCATAGAAGCTCTGGGG - Intergenic
937112609 2:119378191-119378213 CTTTTTCCAAAGAAGCTCTGGGG + Intergenic
938977086 2:136489788-136489810 AATTTTCCATAGAAAATATGAGG - Intergenic
940838593 2:158553368-158553390 AATTTTCCAGGGAAGATCTGTGG + Intronic
945683906 2:212946089-212946111 CACTTTCTATTAAAGGTCTGGGG + Intergenic
947314908 2:228846223-228846245 CATATTCCACAGAAGAACTGAGG + Intergenic
947327718 2:228996004-228996026 TAGTTTCCATAGAATATATGTGG + Intronic
947601857 2:231456341-231456363 CACTTTCCATAGAAGATCTGGGG - Intronic
948682654 2:239646426-239646448 CATTTTCCAGAGCTGATCTGGGG + Intergenic
1182145968 22:27996822-27996844 CCCTTTCCCTACATGATCTGGGG - Intronic
1182823135 22:33236483-33236505 CACTTCCCAAAGAAGATTTTGGG - Intronic
949885901 3:8693786-8693808 GAGTGTCCATAGAAGCTCTGGGG - Intronic
950329419 3:12144706-12144728 TACTTTCCAAAGGAGATTTGAGG - Intronic
950954195 3:17033921-17033943 CACTTTCCTTATAAGCCCTGTGG + Intronic
950974509 3:17226492-17226514 CAGTTTCCAGAGAAGAACTCAGG - Intronic
956008426 3:64805039-64805061 CATTTTCCATAGAAAAACTTAGG - Intergenic
957218077 3:77347597-77347619 CAGTTTGCATAGAATATTTGGGG - Intronic
959979344 3:112497788-112497810 GACTTTCCATAGAACCTCAGTGG + Intronic
960455220 3:117862980-117863002 CTCTTTCCATAGAAGAAATGAGG - Intergenic
961273564 3:125708991-125709013 GAGTGTCCATAGAAGTTCTGGGG - Intergenic
961441060 3:126953452-126953474 CACTTGGCAGAGAAGAGCTGAGG - Intronic
969725804 4:8917466-8917488 CACTGTCCTGAGAAGCTCTGGGG - Intergenic
969735504 4:8987050-8987072 GAGTGTCCATAGAAGATTTGGGG - Intergenic
969916214 4:10493855-10493877 CACTGTTCATAGAATAACTGAGG - Intronic
973050761 4:45593161-45593183 AACTTACCTTAGAAGGTCTGAGG - Intergenic
975727900 4:77309867-77309889 CACTTTCCAGAAAACATATGTGG - Intronic
976256353 4:83104573-83104595 CACTTTACAGAGATGATGTGAGG + Intronic
977612721 4:99052831-99052853 CAATTTTCAAAGAAGTTCTGTGG - Intronic
981774900 4:148355215-148355237 CACTTTCCCCAGAAGATATATGG - Intronic
984284930 4:177716858-177716880 CATTTTCCATTAAAAATCTGGGG - Intergenic
986501168 5:8401296-8401318 TATTTTTCATGGAAGATCTGGGG - Intergenic
987595703 5:19995830-19995852 CACCTTCCATAGAATATCCTGGG + Intronic
988435979 5:31176097-31176119 CACCTTACATAGATGATCTCAGG + Intergenic
990766607 5:59190788-59190810 CACTCTTCATAGAGCATCTGTGG - Intronic
991926091 5:71706344-71706366 CACTTTGCATACAAGATTTCAGG - Intergenic
993806277 5:92414046-92414068 CATTTTACATATAAGATCTAAGG - Intergenic
995130105 5:108620993-108621015 CACCTTCCCCAGAAGATCTCAGG - Intergenic
997023554 5:130030833-130030855 AACTTTCCATTGAAGATTTGAGG + Intronic
1000203795 5:159037901-159037923 CTCTTTCCCTAGGAGATCAGAGG - Intronic
1003036226 6:2642668-2642690 CAATTTGCAGATAAGATCTGAGG - Intergenic
1003523021 6:6874717-6874739 CACTTCCCAGAGAAGAACTGAGG + Intergenic
1004120240 6:12814459-12814481 CGCTTTCCAGAGAGTATCTGTGG - Intronic
1009746280 6:67820815-67820837 CACTTTCCTGATAAGATCTCAGG - Intergenic
1009919732 6:70042694-70042716 CAATTTCAAAAGAAGTTCTGTGG - Intronic
1011505432 6:88037070-88037092 CTTTTTCCCTAGTAGATCTGGGG - Intergenic
1012655434 6:101812847-101812869 CACCTTCTATAGAAGACATGAGG + Intronic
1014494516 6:122104529-122104551 AATTTTCCACACAAGATCTGTGG - Intergenic
1014531495 6:122564218-122564240 CACTTCCTTTAGAGGATCTGTGG + Intronic
1015709373 6:136122364-136122386 CACTTGCTATATAAGATATGAGG - Intronic
1017716128 6:157214703-157214725 CAATTTCAATAAAAGTTCTGTGG - Intergenic
1018643288 6:165924739-165924761 TAATTTCCATATAAGGTCTGAGG - Intronic
1018791075 6:167148209-167148231 CACTTTTGATTGAAGATGTGGGG + Intronic
1019223753 6:170494679-170494701 CAAGTTACATACAAGATCTGTGG + Intergenic
1019900298 7:4015271-4015293 CACATTCCAGGGAAGAGCTGAGG - Intronic
1021038511 7:15831394-15831416 AACTTTCCCTAGAAGAACTAAGG - Intergenic
1021189612 7:17604624-17604646 CACTATCCAGAGGAGATTTGGGG + Intergenic
1024439695 7:49402515-49402537 GACTTCCAATAGAAAATCTGGGG + Intergenic
1024459135 7:49642241-49642263 CACCTCCCATAGAACATCTTTGG + Intergenic
1028188956 7:87823317-87823339 CCCTTTCCATAGAAATCCTGAGG + Intronic
1029964873 7:104729095-104729117 TAATTTCCATAAAAGTTCTGTGG + Intronic
1031662731 7:124446421-124446443 CACTTACCAAAGAAGATATATGG - Intergenic
1032270629 7:130401587-130401609 AACTTTCCATAGCAGAACTTAGG - Intronic
1032339101 7:131054493-131054515 CAATCACCATAGAAGGTCTGTGG + Intergenic
1034755102 7:153609529-153609551 CATTTTCCAGAGAAAAACTGGGG - Intergenic
1036793161 8:11736854-11736876 CCTTTTACAAAGAAGATCTGAGG + Intronic
1036904951 8:12700193-12700215 GAGTGTCCATAGAAGCTCTGGGG + Intergenic
1039026118 8:33260245-33260267 GACTTTTCAGAGAAGCTCTGGGG - Intergenic
1039571867 8:38593202-38593224 CACTTTCCAGAGAGCATCAGAGG - Intergenic
1039990566 8:42484364-42484386 CAGTCTCCATAGAAGATGAGAGG - Intronic
1042095289 8:65208994-65209016 CATTTTCTAAACAAGATCTGTGG - Intergenic
1046593502 8:116233664-116233686 AACTATTCATAGAAGATCTTGGG + Intergenic
1046695424 8:117334089-117334111 CACTTTCCACTGCAGATCTGTGG - Intergenic
1055501650 9:76907351-76907373 CACTTTCCACAGAAATGCTGTGG - Intergenic
1056509117 9:87285823-87285845 CAAGGTCCATAGAAGAGCTGGGG - Intergenic
1059052404 9:110940432-110940454 AACTTTCCATTGAATTTCTGTGG + Intronic
1190075835 X:47316550-47316572 CTCTTTCCATAGAGTATCTAGGG - Intergenic
1191235540 X:58130960-58130982 CTCTATCCTTAGAAGAACTGAGG - Intergenic
1191248018 X:58243309-58243331 CACTATCCTTAGAATGTCTGGGG - Intergenic
1196538226 X:116873046-116873068 CTCTTCTCATTGAAGATCTGAGG + Intergenic
1196645093 X:118109473-118109495 CAATATTCATAGAAAATCTGAGG - Intronic
1196780002 X:119375355-119375377 AACTTTGCATAGAAGGACTGTGG + Intergenic
1198167308 X:134070625-134070647 CACTTGCAAGAGAAGATGTGGGG - Intergenic
1199904680 X:152212949-152212971 CTATTTCCATAGAGGAGCTGGGG + Intronic