ID: 947605765

View in Genome Browser
Species Human (GRCh38)
Location 2:231484131-231484153
Sequence GGCCCGCGGACCCAGCGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 152}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947605751_947605765 9 Left 947605751 2:231484099-231484121 CCCAGTGTCCCTTCCTGCGGTCT 0: 1
1: 0
2: 0
3: 12
4: 146
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605754_947605765 1 Left 947605754 2:231484107-231484129 CCCTTCCTGCGGTCTGGACGTGG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605760_947605765 -4 Left 947605760 2:231484112-231484134 CCTGCGGTCTGGACGTGGGGGCC 0: 1
1: 0
2: 1
3: 8
4: 117
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605756_947605765 0 Left 947605756 2:231484108-231484130 CCTTCCTGCGGTCTGGACGTGGG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605747_947605765 16 Left 947605747 2:231484092-231484114 CCGCCCTCCCAGTGTCCCTTCCT 0: 1
1: 2
2: 19
3: 368
4: 4579
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605746_947605765 17 Left 947605746 2:231484091-231484113 CCCGCCCTCCCAGTGTCCCTTCC 0: 1
1: 0
2: 7
3: 86
4: 1016
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605749_947605765 12 Left 947605749 2:231484096-231484118 CCTCCCAGTGTCCCTTCCTGCGG 0: 1
1: 0
2: 2
3: 16
4: 213
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605752_947605765 8 Left 947605752 2:231484100-231484122 CCAGTGTCCCTTCCTGCGGTCTG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152
947605748_947605765 13 Left 947605748 2:231484095-231484117 CCCTCCCAGTGTCCCTTCCTGCG 0: 1
1: 0
2: 2
3: 30
4: 307
Right 947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947605765 Original CRISPR GGCCCGCGGACCCAGCGTGG GGG Intergenic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
901075895 1:6554496-6554518 GCCCTGAGGACCCAGCATGGCGG - Exonic
901381635 1:8878468-8878490 CGCCCGCAGGCCCAGCGTGGCGG - Intronic
901806533 1:11742112-11742134 GGCCTGCGCCCCCAGCGGGGAGG + Intronic
902405649 1:16182011-16182033 GGCCAGCGGACACAGGGTTGGGG + Intergenic
903806017 1:26006114-26006136 GGTCAGGGGACCCAGGGTGGGGG + Intergenic
916479846 1:165205243-165205265 GGCCTGAGGACCCAGAGTAGGGG - Intronic
922783264 1:228269835-228269857 GGCGTGCGGCCCCTGCGTGGCGG - Intronic
1067431584 10:46249278-46249300 GGCCTGGGGGCCCAGCATGGGGG + Intergenic
1067441836 10:46312896-46312918 GGCCTGGGGGCCCAGCATGGGGG - Intronic
1073045928 10:100638113-100638135 GGCCCCCGGACCAAGGGGGGCGG - Intergenic
1077109744 11:856936-856958 GCCCCGAGGCCCCAGCGTGCTGG - Intronic
1077215970 11:1395283-1395305 AGCCCGGGGAGCCAGCATGGTGG + Intronic
1077413698 11:2414876-2414898 AGGCCGCGGGCCCAGCGCGGGGG - Intronic
1077491087 11:2861389-2861411 GGGCCCCGGACCCAGCCTGAGGG - Intergenic
1078514134 11:12008648-12008670 GGGCGGCGGGCCCAGCGAGGGGG - Intronic
1079400680 11:20104142-20104164 GGCCCACAGACCCAGCTAGGTGG - Intronic
1082986085 11:59172377-59172399 GGCGCGCGGTCCCAGCCAGGCGG + Intronic
1083812118 11:65112020-65112042 GGCCCGGGGGCCCTGAGTGGGGG - Exonic
1083923815 11:65794146-65794168 GGCCCCCGGGCCCTGTGTGGTGG + Exonic
1084128819 11:67118589-67118611 GTCCCGCGGGCCCAGCCCGGCGG + Intergenic
1084728237 11:71056059-71056081 GGTCCGCTGTCCCAGAGTGGAGG - Intronic
1090358953 11:126159775-126159797 GGCCCCTGGCCCCAGCGGGGCGG + Intergenic
1090710082 11:129375966-129375988 GCCCCGCGGCCCCAGCGGGCCGG + Exonic
1097877137 12:64653909-64653931 GGCCATGGGACCCAGCTTGGAGG + Intronic
1102134210 12:110559436-110559458 GGGTCTCGGGCCCAGCGTGGTGG + Intronic
1104852376 12:131883431-131883453 GGCCCTAGGATCCAGCCTGGTGG - Intergenic
1105000341 12:132686844-132686866 GGGCCGGGGACCCTGCCTGGGGG - Intronic
1105699707 13:22926763-22926785 GGACCCCAGACCCAGCGAGGAGG - Intergenic
1110318256 13:74134498-74134520 GCGCCGCGGACCCAGCCCGGCGG - Intergenic
1110630100 13:77697851-77697873 GGCCCGAGGAGCCGGCGCGGCGG + Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118796673 14:69151675-69151697 GGCCCGCGACCCCAGGGAGGAGG + Intronic
1121087119 14:91155076-91155098 GGCCTGTGGACTCAGGGTGGAGG - Intronic
1121410469 14:93745481-93745503 GGCCCCCAGCCCCAGCCTGGTGG + Intronic
1122364574 14:101187055-101187077 GGCCCTGGGAGCCAACGTGGGGG - Intergenic
1122930066 14:104929019-104929041 GGCCCGGGGGCTCAGCTTGGTGG + Intronic
1124500419 15:30223239-30223261 GGCCCGAGGGCCCGGCGCGGGGG + Intergenic
1124743154 15:32315427-32315449 GGCCCGAGGGCCCGGCGCGGGGG - Intergenic
1126348026 15:47717273-47717295 GGGCCGCGGCGCCAGGGTGGGGG + Intronic
1126967240 15:54068391-54068413 AGCCCCCAGACCCAGTGTGGTGG - Intronic
1131257360 15:90871491-90871513 GGCCCGCGTTCCCAGCGCCGTGG - Intronic
1132344877 15:101102156-101102178 GGCCCGAGGACCCAGCTAGAGGG + Intergenic
1132799571 16:1745224-1745246 AGGCCGGGGACCCAGCGTGGAGG + Intronic
1135565855 16:23510420-23510442 CGCCCGCGGCCGCAGCGTCGGGG - Exonic
1136549928 16:30977606-30977628 GGGGCGCTGCCCCAGCGTGGTGG + Intronic
1136704913 16:32179171-32179193 GGCCTGGGGACCCAACCTGGGGG - Intergenic
1136763001 16:32750236-32750258 GGCCTGGGGACCCAACCTGGGGG + Intergenic
1136805099 16:33120150-33120172 GGCCTGGGGACCCAACCTGGGGG - Intergenic
1137696966 16:50468156-50468178 GGCCGTCGGACCCAGGCTGGCGG + Intergenic
1139637236 16:68264936-68264958 GGCCCGCGCACTCAGCGTCCCGG - Intronic
1141486446 16:84343351-84343373 GGACCCCGGGCCCAGCGTGATGG - Intergenic
1141800419 16:86304177-86304199 TGCCCGGGCGCCCAGCGTGGAGG - Intergenic
1142092822 16:88224241-88224263 GGCCCGGGCACGCAGGGTGGCGG - Intergenic
1142112732 16:88340888-88340910 AGCCCGGGGGCCTAGCGTGGAGG + Intergenic
1142230950 16:88900083-88900105 GGACGGCGGGCCCAGCGTGCAGG - Intronic
1142379157 16:89721849-89721871 GGTCCGCGGCCCGGGCGTGGCGG + Intronic
1203065153 16_KI270728v1_random:1010558-1010580 GGCCTGGGGACCCAACCTGGGGG + Intergenic
1142858212 17:2744941-2744963 TGCCTGTGGTCCCAGCGTGGAGG + Intergenic
1143032765 17:3976931-3976953 GGCCCGGGAACCCAGAGAGGTGG + Intergenic
1143733536 17:8894730-8894752 GGGCTGGGGACCCAGCGGGGTGG + Intronic
1147336654 17:39730362-39730384 GGCCCGCGGGACCAGGGTGCGGG + Intronic
1147793052 17:43025202-43025224 GGGCCGCGGACCCGGGGCGGGGG + Intergenic
1151320394 17:73349160-73349182 GGGCCCCGGAGCCAGCCTGGCGG + Intronic
1151980623 17:77506409-77506431 GGCCCGGGGACACAGCCAGGTGG + Intergenic
1152383765 17:79956539-79956561 GACCACCGGGCCCAGCGTGGTGG - Intronic
1157501465 18:48193815-48193837 GGTCCAGGGACCCATCGTGGGGG + Intronic
1157592268 18:48843003-48843025 TGCCCGGGGTCCCAGCCTGGTGG + Intronic
1160377310 18:78422757-78422779 GGCCTGCGGACTCAGCCTTGTGG + Intergenic
1160718731 19:588547-588569 GGCCGGCGGGGCCGGCGTGGGGG + Intergenic
1160719274 19:590283-590305 GGCCCGAGGGCCCGGCGCGGGGG + Exonic
1160762381 19:791993-792015 GGCCTGAGGGCCCAGGGTGGGGG + Intergenic
1160841816 19:1149779-1149801 GGCCCCGGGACCCTGCTTGGAGG + Intronic
1160897686 19:1410335-1410357 GGCACGCGGACCCTACATGGTGG + Intronic
1160988707 19:1851962-1851984 GGCCGGGGGACCCTCCGTGGAGG + Intergenic
1161315328 19:3614833-3614855 GGCCCAGGCCCCCAGCGTGGGGG + Intronic
1161349942 19:3785973-3785995 GGCGATCGGACCCCGCGTGGTGG - Intronic
1162299964 19:9838856-9838878 GGGCAGAGGACCCAGCCTGGGGG + Intronic
1164658588 19:29942532-29942554 GGCCCGCGGGCCCGTCATGGAGG + Exonic
1166297338 19:41895517-41895539 GGCCCGGCGATCCAGGGTGGGGG + Intronic
1166372697 19:42310920-42310942 GGCCTGAGGAGCCAGCATGGTGG + Intergenic
1166990635 19:46690534-46690556 GGCCAGCTGACCCAGTGTAGGGG - Intronic
1167258259 19:48443557-48443579 GGCCCGGCGGCCCAGGGTGGAGG - Exonic
1167612435 19:50513947-50513969 TCCCCGCAGGCCCAGCGTGGGGG + Intronic
928303505 2:30147244-30147266 CGCCCGCGGTCCCAGCGCCGGGG - Intronic
930719762 2:54627788-54627810 GGCCAGCGGGGCCAGGGTGGGGG - Intronic
932770569 2:74498696-74498718 GGGCAGCCGACCCAGCGTGGTGG + Intronic
936040111 2:109143067-109143089 AGCCCGGGAACCCAGTGTGGGGG + Intronic
937886324 2:126901976-126901998 GGCCCCAGGACCCAGGATGGAGG - Exonic
938318452 2:130345947-130345969 GGCCCGCAGCCCCAGCCTGAAGG - Intronic
941096630 2:161245020-161245042 GGCGCGCGGCCCCTGCGTGGCGG - Intergenic
942320377 2:174730841-174730863 GGCAGGAGGCCCCAGCGTGGAGG - Intergenic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
947748634 2:232522014-232522036 GGCCCACGGCCGCATCGTGGGGG + Exonic
948711408 2:239827795-239827817 GGCCCGGGGCCCCAGGGTGGTGG - Intergenic
1168761052 20:349676-349698 CAGCCGCGGCCCCAGCGTGGAGG + Exonic
1171896961 20:30816341-30816363 GACCCGCGGCCCCGGGGTGGCGG - Intergenic
1172064152 20:32207569-32207591 GGCGCGCGGACGCAGCGAGACGG + Intronic
1175249974 20:57603351-57603373 GGCCTGGGGACCCAGGGTCGGGG + Intergenic
1175901535 20:62361744-62361766 GGCCCGGGTACCCAGCCTTGAGG - Intronic
1176120913 20:63454234-63454256 GGCCCGCAGACCCTGCATGAAGG + Intronic
1176286163 21:5020632-5020654 GGCCCCCGGATACCGCGTGGGGG - Intergenic
1176311655 21:5154026-5154048 GGGCCGCGGAGCCGGCCTGGGGG - Intronic
1178981465 21:37268093-37268115 GGCCCGCGGAGCCCGGCTGGCGG - Intergenic
1179871018 21:44242843-44242865 GGCCCCCGGATACCGCGTGGGGG + Intergenic
1180795948 22:18605481-18605503 GGCCAGGGGACACAGCATGGGGG + Intergenic
1181031279 22:20149833-20149855 GGCCAGTGGGCCCAGCGGGGAGG - Intronic
1181225774 22:21389790-21389812 GGCCAGGGGACACAGCATGGGGG - Intergenic
1181252860 22:21545023-21545045 GGCCAGGGGACACAGCATGGGGG + Intergenic
1183545245 22:38451947-38451969 GGCCCGTGGATCCAGCATGCTGG - Intronic
1184059594 22:42074053-42074075 GGCCCGCGGACCGTCCGAGGGGG + Intergenic
1184289351 22:43490146-43490168 GGCCCCCGGACCCAATGTTGTGG + Intronic
950032632 3:9862669-9862691 GCCCCGGGGACCCAGCGGAGAGG + Intergenic
952889270 3:38029868-38029890 GGCCCGCGGCCCGTGGGTGGCGG - Intergenic
954107282 3:48416119-48416141 GGCCCGCGGCCCCAGAGCTGGGG - Exonic
954450860 3:50570999-50571021 GGCCCCTGGACCCAGCTGGGTGG - Exonic
955187728 3:56731249-56731271 GGCCCCCGGGCCCAGCCTGGAGG - Intronic
955416474 3:58696561-58696583 GGACCTTGGACCCAGTGTGGGGG - Intergenic
956035924 3:65091870-65091892 GGCCAGAGGACCTAGGGTGGTGG + Intergenic
960088362 3:113614300-113614322 GGCCCGCCTCCCCAGTGTGGTGG + Intronic
963827309 3:149970280-149970302 GGCGCGCGGGCCCCGGGTGGAGG - Intronic
964165327 3:153697618-153697640 GCAACGCGGGCCCAGCGTGGTGG - Intergenic
964743236 3:159988766-159988788 AGGCCGGGGACCCAGGGTGGTGG + Exonic
968224856 3:196967214-196967236 GGCCCTCGGACTCAGCGAGCTGG - Intronic
968489233 4:881197-881219 GCCCCGTGGCCCCACCGTGGCGG - Intronic
968494419 4:907453-907475 GGCCCGGGGAGTCAGAGTGGGGG + Intronic
968573957 4:1356343-1356365 GCCCCGCGTCCCCAACGTGGTGG + Intronic
968809368 4:2793099-2793121 GGCCCGCGGGCCCTGGGTCGAGG - Intronic
969444116 4:7234474-7234496 GGCCCAGTGACCCAGCATGGTGG + Intronic
981348216 4:143699826-143699848 CACCCGCGGACCCAGCGTCTTGG + Exonic
985644628 5:1079101-1079123 GCCCCGCGGGCCCAGCCTGCCGG + Intronic
986151642 5:5135247-5135269 GGTCTGCGGACCCACCGTAGGGG - Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
991970149 5:72133048-72133070 GGACCATGGACCCAGGGTGGAGG - Intronic
996379043 5:122845522-122845544 GCCCCGCGGGCGCAGCGGGGCGG + Exonic
998266795 5:140672959-140672981 AGCCCACGGACCCAGCGCGCGGG + Intronic
998394840 5:141811858-141811880 GGGCCGAGGTCCCAGCGTGGTGG - Intergenic
1000652453 5:163833727-163833749 GGGCCATAGACCCAGCGTGGTGG - Intergenic
1002795902 6:470930-470952 GGCCCCCGTACCAAGGGTGGAGG + Intergenic
1003035006 6:2634351-2634373 GGCCTGCGGGCGCGGCGTGGCGG - Intronic
1012062861 6:94511043-94511065 GGACCTCGGACCCACGGTGGAGG - Intergenic
1021455352 7:20824128-20824150 GGACCGCTGACCGGGCGTGGTGG - Intergenic
1026858438 7:73769794-73769816 GGCCCGCGCCCTCATCGTGGTGG - Exonic
1029367806 7:100127620-100127642 GGCCCGTGGCCCCATCCTGGTGG + Exonic
1037903015 8:22698948-22698970 CGCCCTTGGACCCAGCATGGAGG + Intergenic
1042489545 8:69381648-69381670 GGCCGGAGGCCCCAGCTTGGAGG - Intergenic
1049655990 8:143797682-143797704 GGACATCAGACCCAGCGTGGGGG + Intronic
1054336284 9:63813101-63813123 GACCCGCGGCCCCGGGGTGGCGG + Intergenic
1054835547 9:69672157-69672179 GGCCCGCGGACCCAGCTGTCAGG - Exonic
1056621777 9:88220925-88220947 GGCACCCGGACTCTGCGTGGAGG + Intergenic
1056711015 9:88991715-88991737 GGGGCGCGGAACCAGGGTGGGGG + Intronic
1060555382 9:124504986-124505008 GGCCCCCGGCCCCGGCGCGGCGG - Intronic
1060913477 9:127369596-127369618 GACCCTTGGACCCAGCGAGGTGG + Intronic
1061089754 9:128420299-128420321 GGGCCGGAGACCCAGCGTGGGGG - Intronic
1061693623 9:132355039-132355061 GGCCGGCCGACTCAGCGCGGGGG - Intergenic
1061771662 9:132928804-132928826 GTCCCGCACACCCAGCATGGGGG + Exonic
1062137696 9:134938375-134938397 GGCCTACGGACCCAGGGAGGGGG + Intergenic
1062345229 9:136111336-136111358 GCCCCGGGGACTCAGGGTGGCGG - Intergenic
1203376214 Un_KI270442v1:380519-380541 GACCCGCGGCCCCGGGGTGGCGG + Intergenic
1195702501 X:107715928-107715950 TGCCTCCGGAGCCAGCGTGGTGG - Exonic
1199274209 X:145922979-145923001 GGTCCCCTGACCCAGCATGGAGG + Intergenic