ID: 947606032

View in Genome Browser
Species Human (GRCh38)
Location 2:231486228-231486250
Sequence TAGAATGAACATTATGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947606028_947606032 30 Left 947606028 2:231486175-231486197 CCTGAACAACATAGTGAGACCAT 0: 4
1: 64
2: 1223
3: 10238
4: 47247
Right 947606032 2:231486228-231486250 TAGAATGAACATTATGGTGTTGG No data
947606029_947606032 11 Left 947606029 2:231486194-231486216 CCATGTCTCTAAAAAATTAATAA No data
Right 947606032 2:231486228-231486250 TAGAATGAACATTATGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947606032 Original CRISPR TAGAATGAACATTATGGTGT TGG Intergenic
No off target data available for this crispr