ID: 947609239

View in Genome Browser
Species Human (GRCh38)
Location 2:231513096-231513118
Sequence TGTTTGCAATAGCACTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947609238_947609239 13 Left 947609238 2:231513060-231513082 CCAGTTTAGTGTGGACTTGTAAT No data
Right 947609239 2:231513096-231513118 TGTTTGCAATAGCACTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947609239 Original CRISPR TGTTTGCAATAGCACTTTTG AGG Intergenic
No off target data available for this crispr