ID: 947610169

View in Genome Browser
Species Human (GRCh38)
Location 2:231520203-231520225
Sequence CTTTTTCTGCTGAAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947610169_947610171 17 Left 947610169 2:231520203-231520225 CCAGCCAACTTCAGCAGAAAAAG No data
Right 947610171 2:231520243-231520265 TCAGTAGCTCAAATATCAACAGG No data
947610169_947610172 21 Left 947610169 2:231520203-231520225 CCAGCCAACTTCAGCAGAAAAAG No data
Right 947610172 2:231520247-231520269 TAGCTCAAATATCAACAGGAAGG No data
947610169_947610173 25 Left 947610169 2:231520203-231520225 CCAGCCAACTTCAGCAGAAAAAG No data
Right 947610173 2:231520251-231520273 TCAAATATCAACAGGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947610169 Original CRISPR CTTTTTCTGCTGAAGTTGGC TGG (reversed) Intergenic
No off target data available for this crispr