ID: 947619094

View in Genome Browser
Species Human (GRCh38)
Location 2:231577190-231577212
Sequence CCCGGGAAGGGTCTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947619083_947619094 0 Left 947619083 2:231577167-231577189 CCTGACCGTACCCCAGCCTGACA No data
Right 947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG No data
947619084_947619094 -5 Left 947619084 2:231577172-231577194 CCGTACCCCAGCCTGACACCCGG No data
Right 947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG No data
947619087_947619094 -10 Left 947619087 2:231577177-231577199 CCCCAGCCTGACACCCGGGAAGG No data
Right 947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG No data
947619082_947619094 19 Left 947619082 2:231577148-231577170 CCTCGTGGGAAGGGAAAGACCTG 0: 375
1: 252
2: 242
3: 209
4: 563
Right 947619094 2:231577190-231577212 CCCGGGAAGGGTCTGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947619094 Original CRISPR CCCGGGAAGGGTCTGTGCTG AGG Intergenic
No off target data available for this crispr