ID: 947621239

View in Genome Browser
Species Human (GRCh38)
Location 2:231592622-231592644
Sequence AAGTACAACCACAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947621239 Original CRISPR AAGTACAACCACAGGGACAC AGG (reversed) Intergenic
901139577 1:7019795-7019817 AGGCACAGGCACAGGGACACAGG - Intronic
902247270 1:15129169-15129191 GAGTAAAACCACAGGACCACAGG + Intergenic
902795218 1:18796354-18796376 AACTCCAGCCACAGGGAGACAGG - Intergenic
903164236 1:21509593-21509615 AAGTTCAACCACGGGGCCAGCGG - Intronic
903567716 1:24281173-24281195 GAGTACAACGACTGGGTCACAGG + Intergenic
905792693 1:40798787-40798809 AGGTCCAAACACAGGGGCACAGG - Intronic
905821105 1:40992101-40992123 AAGTACAATCATAGGGAGAGTGG - Intronic
910264000 1:85319479-85319501 AAATACAACCACAGGAAAAATGG - Exonic
911722267 1:101204300-101204322 AAGTTCAAACACAGTGTCACAGG - Intergenic
912112213 1:106357362-106357384 AAGTACAAAGGCAGGGACAATGG + Intergenic
913232100 1:116748478-116748500 TCGTACAATCAGAGGGACACAGG + Intergenic
917021540 1:170593708-170593730 AAGTAGAAACACAGGGAAATAGG + Intergenic
917562543 1:176174309-176174331 ATTTACAAGCACAGGGACAAAGG + Intronic
917685016 1:177406939-177406961 AAGTAGAACCAAAAAGACACAGG - Intergenic
920957488 1:210632870-210632892 ATGTAAAACCACAGGGACCCAGG + Intronic
923230442 1:231981659-231981681 ATGGACAACCACAGGCTCACTGG - Intronic
1063177706 10:3567397-3567419 AACAACAACCACAGGCACAAAGG + Intergenic
1064799450 10:19052419-19052441 AAGTTCAACTACATGGACAGTGG - Intronic
1065643836 10:27814183-27814205 AAGTGCACCCACAGGGACTCTGG - Intronic
1067187684 10:44044249-44044271 AAGTGCACGCACAGGCACACAGG + Intergenic
1067303722 10:45038353-45038375 AAGAACCACCACAGGAACATAGG + Intergenic
1067725245 10:48765472-48765494 CAGAACATGCACAGGGACACAGG + Intronic
1071619650 10:87107659-87107681 TAGGACAACCACAGTCACACTGG - Intronic
1072493053 10:95927865-95927887 AAGGGCAACCCCAGGGAAACAGG - Intronic
1073426723 10:103459524-103459546 AGGCACACCCACAGAGACACAGG - Intergenic
1078115413 11:8444603-8444625 GAATATAACCACAGGTACACAGG + Intronic
1078767503 11:14312802-14312824 AAGTAAAACAACAGTGATACAGG - Intronic
1083986762 11:66220715-66220737 ATGTACAACCCCAGCGACAGTGG + Exonic
1087737260 11:101849014-101849036 AAGTACAACCACAGCCAGAGTGG - Intronic
1088205265 11:107385602-107385624 AAGTAAAACCACAGGTAAAGGGG - Intronic
1093304797 12:17502048-17502070 AAGTACAAGTACAGGGAAGCTGG - Intergenic
1096276216 12:50210447-50210469 AAGAACAACCAAAAGGAAACGGG + Intronic
1097794534 12:63847219-63847241 AAGTGGAACCACAGGCACACTGG - Intronic
1098037086 12:66315038-66315060 ACCTATAACCACAGGGAAACTGG - Intronic
1098192043 12:67959805-67959827 AAGTTGAAATACAGGGACACAGG + Intergenic
1099945445 12:89238748-89238770 GAGAACAATCACAGGAACACTGG + Intergenic
1100716157 12:97308067-97308089 TAGTACAACCAAAAGAACACTGG - Intergenic
1100747336 12:97660845-97660867 AAGAACAAGCAAAGGGGCACGGG + Intergenic
1101203768 12:102464666-102464688 TAGAAGAACCACAGGGTCACTGG + Intronic
1102530453 12:113542619-113542641 AACTTCAGCCACAGGCACACAGG - Intergenic
1103160970 12:118729120-118729142 AAGAACATCCCCAGGGACCCAGG + Intergenic
1103360641 12:120351469-120351491 AAATGCACCCACAGGGACACTGG + Intronic
1104571479 12:129929809-129929831 AGGGACAACAACAGGGAAACAGG - Intergenic
1105621398 13:22070825-22070847 AAGTCCTCCCACAGTGACACTGG - Intergenic
1106529671 13:30577966-30577988 AAGTTCCACTACAGGAACACAGG + Intronic
1109224194 13:59672659-59672681 AAGGAAAACCACAGGGATATGGG - Intronic
1113049452 13:106193314-106193336 CAGTAAGAACACAGGGACACAGG + Intergenic
1119613467 14:76082955-76082977 CAGTACAGCCACAGGGACAGAGG - Intronic
1120440385 14:84529659-84529681 AAGTACAAACACAGGAATAGAGG - Intergenic
1124664329 15:31579360-31579382 AAGTACAAGAACAGTGATACTGG - Intronic
1125450528 15:39802140-39802162 TACTGCAAACACAGGGACACTGG + Exonic
1127302608 15:57670896-57670918 AATTATAACCACAGGCACAGCGG - Intronic
1127682072 15:61307436-61307458 AAGTCCAACCACACGGCAACAGG - Intergenic
1128092727 15:64930042-64930064 AATGAGAACCACATGGACACAGG + Intronic
1131068144 15:89447522-89447544 ACGTACAATCACATGCACACAGG + Intergenic
1131962413 15:97803647-97803669 CAGTACAATCACAGGGGCAGGGG - Intergenic
1133554730 16:6894779-6894801 AATTACAAACACAGGGAAAATGG - Intronic
1133694566 16:8249576-8249598 AATGAGAACCACAGAGACACAGG + Intergenic
1139185157 16:64797578-64797600 AAGTAGAATTACAGGGCCACAGG - Intergenic
1139684409 16:68591627-68591649 AAATAAAACCACAGCTACACAGG - Intergenic
1142322290 16:89391303-89391325 AAGCACAGCCACAGGAACCCAGG + Intronic
1144623155 17:16831151-16831173 AAGCACAACCACAGAGATGCTGG - Intergenic
1144883276 17:18441565-18441587 AAGCACAACCACAGAGATGCTGG + Intergenic
1145148952 17:20502821-20502843 AAGCACAACCACAGAGATGCTGG - Intergenic
1147757688 17:42779752-42779774 ATGTAAAACCACAGGCTCACTGG - Intergenic
1147777567 17:42913518-42913540 AAATGCATCCACAGGGGCACAGG + Intergenic
1148722322 17:49763225-49763247 ACGTACAACTTCTGGGACACAGG + Intronic
1150197302 17:63313624-63313646 CAGTACAGGCACAGAGACACTGG + Intronic
1151590396 17:75040162-75040184 AACTACAAACACAAGGGCACGGG + Exonic
1152299974 17:79489761-79489783 AAGTAGAACCACTGGCACCCAGG - Intronic
1152946337 17:83199467-83199489 AAGGACAAGCTCAGGGACATGGG - Intergenic
1157231149 18:45917119-45917141 AAGTACATCCAAAGGCACAAGGG - Intronic
1157582697 18:48782630-48782652 CAGTGCACCCACAGGGCCACAGG + Intronic
1158174102 18:54634637-54634659 GAGAACAAACACATGGACACAGG - Intergenic
1158862392 18:61605569-61605591 AAGTAAAGCCACAGGAAAACTGG - Intergenic
1160699611 19:499518-499540 GTGTACAAACACAGGCACACAGG + Intronic
925201506 2:1970599-1970621 AAGCACAACCACAGAGCCCCCGG - Intronic
925696098 2:6580764-6580786 AAGTACAGTGACAGAGACACAGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927842590 2:26455048-26455070 AAGTACAACCACCAAGACCCTGG + Intronic
929074352 2:38066014-38066036 AAATCCAAACACAGGCACACTGG + Intronic
929269236 2:39955058-39955080 AAGTACAACTACAGACAAACAGG + Intergenic
929663074 2:43808940-43808962 AAGTAAAATCACTGGGACAAAGG + Intronic
929854229 2:45622130-45622152 AAGAAAAGCCACAGGGAAACAGG + Intergenic
932381822 2:71290861-71290883 AATTAAAACAACAGGAACACAGG - Intronic
934306822 2:91832092-91832114 AGGTTAAACCACAGGGACCCAGG + Intergenic
934326434 2:92020650-92020672 AGGTTAAACCACAGGGACCCAGG - Intergenic
934464798 2:94251267-94251289 AGGTTAAACCACAGGGACCCAGG - Intergenic
937120127 2:119435193-119435215 AATTTCAACCCCAGGGATACAGG - Intronic
937300496 2:120836548-120836570 AAGTTCTCCCACAGGGACACAGG - Intronic
937773384 2:125747659-125747681 AAGAACAAACACAGAGACAGGGG - Intergenic
938595273 2:132782599-132782621 AAGTACAGCCACATTGGCACTGG + Exonic
941116336 2:161476840-161476862 AATGAGAACAACAGGGACACTGG + Intronic
943636790 2:190316006-190316028 ATGTACAATCACTGAGACACTGG + Intronic
943765123 2:191652553-191652575 AAGAACAAATACAGGGACTCTGG + Intergenic
946636684 2:221736362-221736384 AATGAGAACCACATGGACACAGG - Intergenic
947027060 2:225748076-225748098 AATGAGAACCACATGGACACAGG + Intergenic
947621239 2:231592622-231592644 AAGTACAACCACAGGGACACAGG - Intergenic
948765765 2:240217888-240217910 TAGTCCAACCACACGGGCACTGG + Intergenic
948873604 2:240816120-240816142 AAGAACAAAGACAGGGACAAGGG + Intronic
1169159180 20:3361637-3361659 AAGTTCAACTACATGGACAGTGG + Intronic
1171417181 20:24990891-24990913 AAGGACAAACACAGGGAAACAGG + Intronic
1172877189 20:38171718-38171740 AGGTTCAACTACAAGGACACGGG + Intergenic
1173284117 20:41655050-41655072 CTGTTCAACCACAGGGCCACTGG + Intergenic
1173453372 20:43185013-43185035 AGATACAGCCACAGGGACAGGGG - Intronic
1174949870 20:55031671-55031693 AAGTCCAACAACAGGAACACAGG + Intergenic
1175721848 20:61292472-61292494 AAGTCCAGCCCCAGGGGCACTGG + Intronic
1175778381 20:61667080-61667102 AAGCACATCCACAGGGACCCTGG - Intronic
1175861110 20:62150990-62151012 AAGGACAACCATGAGGACACTGG + Intronic
1176595835 21:8694438-8694460 AGGTTAAACCACAGGGACCCAGG - Intergenic
1177305234 21:19306701-19306723 AAGCACACCCACAGGGACTCTGG + Intergenic
1179829697 21:43988937-43988959 AAGTCCAACCGCAGGTACCCTGG + Intergenic
1180585950 22:16890414-16890436 AGGTTAAACCACAGGGACCCAGG - Intergenic
1180757617 22:18173602-18173624 AAGTTTAAACACAGGGACAAGGG + Intronic
1181074157 22:20363843-20363865 AAGTTTAAACACAGGGACAAGGG - Intronic
1181621848 22:24096587-24096609 ACTTACAACCACAGGGAGACTGG - Intronic
1182468157 22:30530968-30530990 AGGGACATCCACAGGGACATTGG + Intronic
1182880593 22:33729703-33729725 AAGATCAACAACAGGAACACAGG + Intronic
1183271538 22:36865493-36865515 AAGGAGAGCCACAGGGACGCTGG - Intronic
1183678965 22:39315825-39315847 AAGGACAGCCACAGGAACATTGG - Intronic
1184259510 22:43306604-43306626 ATGTACAAGCACAGGGAGAGTGG + Intronic
1185190269 22:49431799-49431821 AAGGGAAACCACAGAGACACAGG - Intronic
950106564 3:10392544-10392566 AAGGACGACCACAGGGGCAGAGG + Intronic
951464777 3:22990199-22990221 AAGTACGGCCACAGGGAGAATGG + Intergenic
954227495 3:49191694-49191716 AGGTACAACCAGAGGGCCAGGGG + Intronic
955801748 3:62693947-62693969 AAGGACAACCACAGTCACAAAGG + Intronic
956971650 3:74533145-74533167 AAATACAACCACAGGCACATAGG - Intergenic
959711354 3:109389182-109389204 AAGTAAAACCAAATTGACACAGG + Intergenic
959937123 3:112040752-112040774 CAGTACAAGCAAAGGGAGACTGG + Intronic
961403793 3:126665201-126665223 AAATTCAGCCAGAGGGACACAGG + Intergenic
965665650 3:171090781-171090803 AGGTAGAACCACAGGGATAAGGG + Intronic
966912065 3:184565240-184565262 ACGCACAGCCACAGGGAAACAGG + Intronic
967763922 3:193256729-193256751 AAGTACAATTACAGGGTCAGAGG - Intronic
968607159 4:1540962-1540984 AGGTCCATCCCCAGGGACACTGG + Intergenic
973862775 4:55082022-55082044 AAGGACAACCAGACGGACAGTGG - Exonic
976964961 4:91026261-91026283 AAGGACAACTACAGAGAAACAGG - Intronic
985849284 5:2376718-2376740 AAGAACAGCCACAGGGCCAACGG + Intergenic
986269402 5:6218010-6218032 AAGGGCAGCCTCAGGGACACAGG - Intergenic
990204823 5:53417263-53417285 AAGTGGAAGCACAGGGACAAAGG + Intergenic
996701877 5:126458031-126458053 AAGTAAAATCCCAGGGAAACTGG - Intronic
997224927 5:132202780-132202802 AAGTACTCCCACTGGGACCCTGG - Intronic
998057742 5:139093371-139093393 AAGTTCTAACACAGGGAGACAGG + Intronic
1000381547 5:160634203-160634225 AAGGAAGACCACAGGGATACAGG + Intronic
1001570809 5:172729464-172729486 AACTAGAACCAAATGGACACTGG + Intergenic
1004818794 6:19342705-19342727 AAATACAACCACTGGGAGAGAGG + Intergenic
1008683835 6:53902940-53902962 AAGCACCACAACTGGGACACAGG - Intronic
1010404657 6:75490162-75490184 AATTATAACCACAAGGAAACCGG + Intronic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1014431107 6:121371802-121371824 AAGTACTACCAGAGGTACAAAGG + Intergenic
1017725876 6:157275439-157275461 AAAGACAGACACAGGGACACAGG - Intergenic
1018952606 6:168389001-168389023 AAGTCCAACCACCGGGGCCCGGG + Intergenic
1024261897 7:47579588-47579610 AAGTTCATACACAGGGACACAGG + Intronic
1024532638 7:50406280-50406302 AAGTCCATCCACATGGAGACAGG + Intergenic
1027757653 7:82235340-82235362 AAGTATTAACACAGGGCCACAGG - Intronic
1027949596 7:84797583-84797605 AAGCACAATCAGAAGGACACGGG - Intergenic
1030987592 7:116260889-116260911 AAGAATAACCACAGGGAAAATGG + Intergenic
1031916897 7:127571891-127571913 AAACAGAACCACAAGGACACTGG + Intergenic
1032464639 7:132136340-132136362 AAGTTCAAGCACAGGGGCCCAGG - Intronic
1034758543 7:153647979-153648001 AACAACAAACACAGGGACTCTGG - Intergenic
1035874960 8:3178239-3178261 TAGTACATCCAAATGGACACTGG - Intronic
1035936683 8:3849243-3849265 AAACAAAACCACAGGAACACGGG + Intronic
1036741771 8:11369252-11369274 AAGTACAATTACTGGGTCACAGG + Intergenic
1039546414 8:38414211-38414233 AAGTTCCTCCACAGGCACACCGG + Exonic
1040719182 8:50296559-50296581 AAATGAAAACACAGGGACACAGG + Intronic
1040779586 8:51092179-51092201 AGGCACAACAACAAGGACACTGG + Intergenic
1042852822 8:73233791-73233813 ATGCACAACCTCAGGGACAAAGG - Intergenic
1044883477 8:96748854-96748876 AAAGAGAACCACAGGGACACAGG - Intronic
1044961710 8:97537772-97537794 AAATACCACTACAGGGACAGAGG + Intergenic
1045774408 8:105785394-105785416 AAGTCCAAACACAGGGTCAGTGG - Intronic
1048110200 8:131460022-131460044 AACTACAACCTCGTGGACACAGG + Intergenic
1049278752 8:141733274-141733296 GGGTAGAACCACAAGGACACTGG + Intergenic
1049478651 8:142809576-142809598 AAGTACAAGCACAGAGAGGCGGG + Intergenic
1051937824 9:22465867-22465889 AAGGAGAACCACAAGCACACAGG + Intergenic
1052661964 9:31444799-31444821 GAGAACAAACACATGGACACAGG - Intergenic
1052836747 9:33255684-33255706 AAATATAATTACAGGGACACAGG + Intronic
1053694882 9:40628026-40628048 AGGTTAAACCACAGGGACCCAGG - Intergenic
1053941867 9:43258406-43258428 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054269959 9:63012093-63012115 AGGTTAAACCACAGGGACCCAGG + Intergenic
1054306126 9:63427250-63427272 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054404868 9:64751229-64751251 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054438492 9:65236721-65236743 AGGTTAAACCACAGGGACCCAGG - Intergenic
1054491912 9:65785227-65785249 AGGTTAAACCACAGGGACCCAGG + Intergenic
1054946864 9:70804991-70805013 AAGTAAAACCAGTGGGACCCTGG - Intronic
1056658713 9:88529294-88529316 TTGGACAACCACAGGGAAACTGG - Intergenic
1060175915 9:121497667-121497689 AAGAACAAAAGCAGGGACACAGG + Intergenic
1060176250 9:121499493-121499515 AAGAACAAAAGCAGGGACACAGG + Intergenic
1062631093 9:137463513-137463535 ACGTACCACCACAGGGAGCCTGG + Exonic
1202777327 9_KI270717v1_random:1632-1654 AGGTTAAACCACAGGGACCCAGG - Intergenic
1185654221 X:1671196-1671218 AAGTACATTCACAAGGACAGGGG - Intergenic
1185954757 X:4477576-4477598 AATCACAAACACAGAGACACAGG + Intergenic
1188593498 X:31868041-31868063 AAGTACTACGACAGGTACTCTGG + Intronic
1189319866 X:40081335-40081357 ATGTACAACGAAGGGGACACTGG + Intronic
1192763661 X:74121797-74121819 AAGTACATTCACAGGGGCAGGGG + Intergenic
1193571494 X:83150424-83150446 AAGTAGAAATACAGAGACACAGG - Intergenic
1195751290 X:108163688-108163710 AAGGACTAACACAGGGACACTGG + Intronic
1196231957 X:113234012-113234034 AAGAACCACCACAGGAACATAGG - Intergenic
1196786083 X:119422637-119422659 AGGTACAACCACACGGACTTGGG - Intronic