ID: 947622980

View in Genome Browser
Species Human (GRCh38)
Location 2:231603011-231603033
Sequence CCGGATTAACGGGCGAGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947622973_947622980 4 Left 947622973 2:231602984-231603006 CCCAGCATGTAGTAGCTTAGGCA No data
Right 947622980 2:231603011-231603033 CCGGATTAACGGGCGAGGTAAGG No data
947622974_947622980 3 Left 947622974 2:231602985-231603007 CCAGCATGTAGTAGCTTAGGCAC No data
Right 947622980 2:231603011-231603033 CCGGATTAACGGGCGAGGTAAGG No data
947622971_947622980 28 Left 947622971 2:231602960-231602982 CCTCTTAATTGAAAGTGACAGAA No data
Right 947622980 2:231603011-231603033 CCGGATTAACGGGCGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947622980 Original CRISPR CCGGATTAACGGGCGAGGTA AGG Intergenic
No off target data available for this crispr