ID: 947625474

View in Genome Browser
Species Human (GRCh38)
Location 2:231615601-231615623
Sequence AAGCTGATCAAGAGGACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947625474_947625478 9 Left 947625474 2:231615601-231615623 CCAGGTGTCCTCTTGATCAGCTT No data
Right 947625478 2:231615633-231615655 TTTAAGGTGTCCCTGTGTCTCGG No data
947625474_947625476 -7 Left 947625474 2:231615601-231615623 CCAGGTGTCCTCTTGATCAGCTT No data
Right 947625476 2:231615617-231615639 TCAGCTTTGCCTGCTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947625474 Original CRISPR AAGCTGATCAAGAGGACACC TGG (reversed) Intergenic
No off target data available for this crispr