ID: 947625852

View in Genome Browser
Species Human (GRCh38)
Location 2:231618225-231618247
Sequence TCATGAGCCCACCTTCATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947625852_947625859 18 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625859 2:231618266-231618288 CCTTCTGAGACGCCCCCCATTGG No data
947625852_947625862 25 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625862 2:231618273-231618295 AGACGCCCCCCATTGGGTGTGGG No data
947625852_947625863 28 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625863 2:231618276-231618298 CGCCCCCCATTGGGTGTGGGTGG No data
947625852_947625861 24 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625861 2:231618272-231618294 GAGACGCCCCCCATTGGGTGTGG No data
947625852_947625864 29 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625864 2:231618277-231618299 GCCCCCCATTGGGTGTGGGTGGG No data
947625852_947625860 19 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625860 2:231618267-231618289 CTTCTGAGACGCCCCCCATTGGG No data
947625852_947625866 30 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625866 2:231618278-231618300 CCCCCCATTGGGTGTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947625852 Original CRISPR TCATGAGCCCACCTTCATGT CGG (reversed) Intergenic
No off target data available for this crispr