ID: 947625854

View in Genome Browser
Species Human (GRCh38)
Location 2:231618249-231618271
Sequence AGAAGGGCATGGAGACCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947625854_947625863 4 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625863 2:231618276-231618298 CGCCCCCCATTGGGTGTGGGTGG No data
947625854_947625862 1 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625862 2:231618273-231618295 AGACGCCCCCCATTGGGTGTGGG No data
947625854_947625866 6 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625866 2:231618278-231618300 CCCCCCATTGGGTGTGGGTGGGG No data
947625854_947625864 5 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625864 2:231618277-231618299 GCCCCCCATTGGGTGTGGGTGGG No data
947625854_947625860 -5 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625860 2:231618267-231618289 CTTCTGAGACGCCCCCCATTGGG No data
947625854_947625859 -6 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625859 2:231618266-231618288 CCTTCTGAGACGCCCCCCATTGG No data
947625854_947625861 0 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625861 2:231618272-231618294 GAGACGCCCCCCATTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947625854 Original CRISPR AGAAGGGCATGGAGACCAGA GGG (reversed) Intergenic
No off target data available for this crispr