ID: 947625861

View in Genome Browser
Species Human (GRCh38)
Location 2:231618272-231618294
Sequence GAGACGCCCCCCATTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947625854_947625861 0 Left 947625854 2:231618249-231618271 CCCTCTGGTCTCCATGCCCTTCT No data
Right 947625861 2:231618272-231618294 GAGACGCCCCCCATTGGGTGTGG No data
947625852_947625861 24 Left 947625852 2:231618225-231618247 CCGACATGAAGGTGGGCTCATGA No data
Right 947625861 2:231618272-231618294 GAGACGCCCCCCATTGGGTGTGG No data
947625855_947625861 -1 Left 947625855 2:231618250-231618272 CCTCTGGTCTCCATGCCCTTCTG No data
Right 947625861 2:231618272-231618294 GAGACGCCCCCCATTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947625861 Original CRISPR GAGACGCCCCCCATTGGGTG TGG Intergenic
No off target data available for this crispr