ID: 947626598

View in Genome Browser
Species Human (GRCh38)
Location 2:231622974-231622996
Sequence CACTTACACCCGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146901
Summary {0: 4, 1: 117, 2: 5642, 3: 38167, 4: 102971}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947626598 Original CRISPR CACTTACACCCGGGAGGCGG AGG Intergenic
Too many off-targets to display for this crispr