ID: 947630854

View in Genome Browser
Species Human (GRCh38)
Location 2:231652178-231652200
Sequence GGTCCGAAGGGGCCTCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947630847_947630854 26 Left 947630847 2:231652129-231652151 CCTAAGTTCACGGAATCCTTAAC No data
Right 947630854 2:231652178-231652200 GGTCCGAAGGGGCCTCAACCTGG No data
947630848_947630854 10 Left 947630848 2:231652145-231652167 CCTTAACTGTAGACTAAGAATCT No data
Right 947630854 2:231652178-231652200 GGTCCGAAGGGGCCTCAACCTGG No data
947630846_947630854 30 Left 947630846 2:231652125-231652147 CCATCCTAAGTTCACGGAATCCT No data
Right 947630854 2:231652178-231652200 GGTCCGAAGGGGCCTCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947630854 Original CRISPR GGTCCGAAGGGGCCTCAACC TGG Intergenic
No off target data available for this crispr