ID: 947634863

View in Genome Browser
Species Human (GRCh38)
Location 2:231674845-231674867
Sequence GCCCTGGGACGTGAGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947634849_947634863 3 Left 947634849 2:231674819-231674841 CCCCACCCTGGGCATCTCCACCC No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634852_947634863 -2 Left 947634852 2:231674824-231674846 CCCTGGGCATCTCCACCCAGAGC No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634853_947634863 -3 Left 947634853 2:231674825-231674847 CCTGGGCATCTCCACCCAGAGCC No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634851_947634863 1 Left 947634851 2:231674821-231674843 CCACCCTGGGCATCTCCACCCAG No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634844_947634863 15 Left 947634844 2:231674807-231674829 CCCTCGACCTTACCCCACCCTGG No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634846_947634863 14 Left 947634846 2:231674808-231674830 CCTCGACCTTACCCCACCCTGGG No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634843_947634863 16 Left 947634843 2:231674806-231674828 CCCCTCGACCTTACCCCACCCTG No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634848_947634863 8 Left 947634848 2:231674814-231674836 CCTTACCCCACCCTGGGCATCTC No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data
947634850_947634863 2 Left 947634850 2:231674820-231674842 CCCACCCTGGGCATCTCCACCCA No data
Right 947634863 2:231674845-231674867 GCCCTGGGACGTGAGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947634863 Original CRISPR GCCCTGGGACGTGAGGGCTG GGG Intergenic
No off target data available for this crispr