ID: 947636487

View in Genome Browser
Species Human (GRCh38)
Location 2:231683077-231683099
Sequence TGCCCCTCTGGTTGCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947636487_947636496 12 Left 947636487 2:231683077-231683099 CCCTGGGGGCAACCAGAGGGGCA No data
Right 947636496 2:231683112-231683134 AGCAGGCTGGCTCTGCAGACAGG No data
947636487_947636497 25 Left 947636487 2:231683077-231683099 CCCTGGGGGCAACCAGAGGGGCA No data
Right 947636497 2:231683125-231683147 TGCAGACAGGCTCTGCAAACAGG No data
947636487_947636494 -1 Left 947636487 2:231683077-231683099 CCCTGGGGGCAACCAGAGGGGCA No data
Right 947636494 2:231683099-231683121 AGCCGAGGCTGGGAGCAGGCTGG No data
947636487_947636493 -5 Left 947636487 2:231683077-231683099 CCCTGGGGGCAACCAGAGGGGCA No data
Right 947636493 2:231683095-231683117 GGGCAGCCGAGGCTGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947636487 Original CRISPR TGCCCCTCTGGTTGCCCCCA GGG (reversed) Intergenic