ID: 947637996

View in Genome Browser
Species Human (GRCh38)
Location 2:231689805-231689827
Sequence CTTTGAGCCAAGTTCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947637996_947638000 -8 Left 947637996 2:231689805-231689827 CCACAGCAGAACTTGGCTCAAAG No data
Right 947638000 2:231689820-231689842 GCTCAAAGTGTTTGTCCTGGGGG No data
947637996_947637998 -10 Left 947637996 2:231689805-231689827 CCACAGCAGAACTTGGCTCAAAG No data
Right 947637998 2:231689818-231689840 TGGCTCAAAGTGTTTGTCCTGGG No data
947637996_947638003 25 Left 947637996 2:231689805-231689827 CCACAGCAGAACTTGGCTCAAAG No data
Right 947638003 2:231689853-231689875 ACATATGTGTGCAATTTTCCTGG No data
947637996_947637999 -9 Left 947637996 2:231689805-231689827 CCACAGCAGAACTTGGCTCAAAG No data
Right 947637999 2:231689819-231689841 GGCTCAAAGTGTTTGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947637996 Original CRISPR CTTTGAGCCAAGTTCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr