ID: 947642259

View in Genome Browser
Species Human (GRCh38)
Location 2:231713748-231713770
Sequence CTCCCCAGTTAAGGCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947642259_947642264 -6 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642264 2:231713765-231713787 GGGGAGGAGGACTTCATCACTGG No data
947642259_947642275 28 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642275 2:231713799-231713821 GGACCCTGGTGCCCTGGGGGTGG No data
947642259_947642272 23 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642272 2:231713794-231713816 CATGGGGACCCTGGTGCCCTGGG No data
947642259_947642277 30 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642277 2:231713801-231713823 ACCCTGGTGCCCTGGGGGTGGGG No data
947642259_947642268 7 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642268 2:231713778-231713800 TCATCACTGGGTGCCACATGGGG No data
947642259_947642266 5 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642266 2:231713776-231713798 CTTCATCACTGGGTGCCACATGG No data
947642259_947642267 6 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642267 2:231713777-231713799 TTCATCACTGGGTGCCACATGGG No data
947642259_947642265 -5 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642265 2:231713766-231713788 GGGAGGAGGACTTCATCACTGGG No data
947642259_947642269 14 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642269 2:231713785-231713807 TGGGTGCCACATGGGGACCCTGG No data
947642259_947642274 25 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642274 2:231713796-231713818 TGGGGACCCTGGTGCCCTGGGGG No data
947642259_947642271 22 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642271 2:231713793-231713815 ACATGGGGACCCTGGTGCCCTGG No data
947642259_947642273 24 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642273 2:231713795-231713817 ATGGGGACCCTGGTGCCCTGGGG No data
947642259_947642276 29 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG No data
Right 947642276 2:231713800-231713822 GACCCTGGTGCCCTGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947642259 Original CRISPR CTCCCCAGTTAAGGCTTCTT GGG (reversed) Intergenic