ID: 947642259

View in Genome Browser
Species Human (GRCh38)
Location 2:231713748-231713770
Sequence CTCCCCAGTTAAGGCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947642259_947642268 7 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642268 2:231713778-231713800 TCATCACTGGGTGCCACATGGGG 0: 1
1: 0
2: 0
3: 14
4: 116
947642259_947642275 28 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642275 2:231713799-231713821 GGACCCTGGTGCCCTGGGGGTGG 0: 1
1: 0
2: 4
3: 48
4: 493
947642259_947642273 24 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642273 2:231713795-231713817 ATGGGGACCCTGGTGCCCTGGGG 0: 1
1: 0
2: 4
3: 21
4: 285
947642259_947642269 14 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642269 2:231713785-231713807 TGGGTGCCACATGGGGACCCTGG 0: 1
1: 0
2: 5
3: 22
4: 246
947642259_947642264 -6 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642264 2:231713765-231713787 GGGGAGGAGGACTTCATCACTGG 0: 1
1: 0
2: 1
3: 30
4: 312
947642259_947642276 29 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642276 2:231713800-231713822 GACCCTGGTGCCCTGGGGGTGGG 0: 1
1: 0
2: 3
3: 41
4: 408
947642259_947642265 -5 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642265 2:231713766-231713788 GGGAGGAGGACTTCATCACTGGG 0: 1
1: 0
2: 1
3: 16
4: 120
947642259_947642277 30 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642277 2:231713801-231713823 ACCCTGGTGCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 53
4: 486
947642259_947642271 22 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642271 2:231713793-231713815 ACATGGGGACCCTGGTGCCCTGG 0: 1
1: 0
2: 1
3: 33
4: 290
947642259_947642274 25 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642274 2:231713796-231713818 TGGGGACCCTGGTGCCCTGGGGG 0: 1
1: 0
2: 2
3: 44
4: 508
947642259_947642266 5 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642266 2:231713776-231713798 CTTCATCACTGGGTGCCACATGG 0: 1
1: 0
2: 0
3: 20
4: 178
947642259_947642267 6 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642267 2:231713777-231713799 TTCATCACTGGGTGCCACATGGG 0: 1
1: 0
2: 0
3: 13
4: 135
947642259_947642272 23 Left 947642259 2:231713748-231713770 CCCAAGAAGCCTTAACTGGGGAG 0: 1
1: 0
2: 0
3: 9
4: 168
Right 947642272 2:231713794-231713816 CATGGGGACCCTGGTGCCCTGGG 0: 1
1: 0
2: 1
3: 43
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947642259 Original CRISPR CTCCCCAGTTAAGGCTTCTT GGG (reversed) Intergenic
900644734 1:3703792-3703814 CTGCCCAGCTGAGGCTTCTCAGG - Intronic
903139492 1:21330702-21330724 CTCCCCATTAAATGCTTCCTAGG + Intronic
904441638 1:30535654-30535676 GTCCTCAGGTAAGGCTTCCTTGG - Intergenic
905524521 1:38626064-38626086 CTCCCCAGGCAGGGATTCTTAGG - Intergenic
906713009 1:47945801-47945823 CTCCCCAGTTTAGGGATATTTGG + Intronic
909960977 1:81842286-81842308 TTCCCCTGATTAGGCTTCTTGGG + Intronic
914265114 1:146031924-146031946 CTCCACATTTCAGTCTTCTTAGG + Intergenic
916345527 1:163786764-163786786 CTTTCCAGTTCAGGGTTCTTTGG - Intergenic
916501718 1:165393154-165393176 CTCCCCAGGGGAGGCATCTTGGG - Intergenic
917881656 1:179343074-179343096 CTCACCATTTGAGGCTTCTCAGG - Intronic
918194967 1:182212776-182212798 CTCCCTAATTGACGCTTCTTGGG + Intergenic
921335188 1:214078506-214078528 TTCCCCAGTTTAGGTTTGTTTGG - Intergenic
922527450 1:226316487-226316509 CTCCCTAGTGAAGATTTCTTAGG - Intergenic
923326480 1:232884742-232884764 CACCCCAGGTAAGGGGTCTTAGG - Intergenic
923928072 1:238658690-238658712 CTACTTACTTAAGGCTTCTTGGG - Intergenic
924379272 1:243446800-243446822 CTGCCCAGTTGGGGCTGCTTGGG + Intronic
1062936849 10:1396580-1396602 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936861 10:1396621-1396643 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936872 10:1396662-1396684 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936896 10:1396744-1396766 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936908 10:1396785-1396807 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936921 10:1396826-1396848 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936932 10:1396867-1396889 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936943 10:1396908-1396930 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062936955 10:1396949-1396971 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936967 10:1396990-1397012 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062936979 10:1397031-1397053 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937002 10:1397113-1397135 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937024 10:1397195-1397217 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937046 10:1397277-1397299 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937057 10:1397318-1397340 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937069 10:1397359-1397381 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937081 10:1397400-1397422 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937104 10:1397482-1397504 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937117 10:1397523-1397545 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937140 10:1397605-1397627 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937162 10:1397687-1397709 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937175 10:1397728-1397750 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937187 10:1397769-1397791 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937210 10:1397851-1397873 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937223 10:1397892-1397914 CTCCCGAGTGGAGGCTTCCTGGG + Intronic
1062937235 10:1397933-1397955 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937246 10:1397974-1397996 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937258 10:1398015-1398037 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937270 10:1398056-1398078 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937283 10:1398097-1398119 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937293 10:1398138-1398160 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937314 10:1398220-1398242 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1062937325 10:1398261-1398283 CTCCCGAGTGCAGGCTTCCTGGG + Intronic
1064601610 10:16999278-16999300 CTCCAAAATTATGGCTTCTTTGG - Intronic
1070932638 10:80272150-80272172 CTCCCCAGATGAGACTTCCTGGG + Exonic
1073296429 10:102442195-102442217 CTCCCCTGCTAAGGCTTTTGGGG - Intergenic
1074035878 10:109737961-109737983 CTCCTCAATGAAGTCTTCTTTGG - Intergenic
1079482916 11:20901434-20901456 CTCCCCAGTTAGGTCTTCAGTGG - Intronic
1084207492 11:67604467-67604489 CTCCCCAGTTCCAGCTCCTTTGG - Exonic
1084271609 11:68032216-68032238 ACCCCCAGCAAAGGCTTCTTTGG - Intronic
1084461860 11:69300654-69300676 CTACCCTGTCAAGGCTTCCTAGG + Intronic
1084462623 11:69304345-69304367 AACCCCAGTCAAGGCTTCTGTGG - Intronic
1086161163 11:83723551-83723573 CCCCCAAGATAATGCTTCTTTGG - Intronic
1086447990 11:86888185-86888207 CTCCCCTGTAAAGCCTTCTAGGG - Intronic
1086871135 11:92038030-92038052 CTCCTCAGTTAAAGTATCTTTGG - Intergenic
1088930571 11:114347293-114347315 CTCCGCAGTTGAGGTTTCCTCGG + Intergenic
1089174485 11:116538550-116538572 CACCCTGGTTAAGCCTTCTTAGG + Intergenic
1089298462 11:117483628-117483650 CTCCCCATTTAAGTCTTGCTGGG - Intronic
1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG + Exonic
1090872383 11:130759977-130759999 CTCCCCAGACTAGTCTTCTTTGG + Intergenic
1094726637 12:33125464-33125486 CTCCCCAGATAATGTTTCTGAGG - Intergenic
1096965569 12:55624537-55624559 CTGTCCATTTAAGGCTTCTCAGG - Intergenic
1100178131 12:92053771-92053793 TTCCCCAGTTAAGTGCTCTTAGG - Intronic
1106779159 13:33039568-33039590 CTCCCCTGTGAAGTCTTGTTTGG - Intronic
1107617879 13:42190508-42190530 CTCACCAGTTATTGATTCTTTGG - Exonic
1108181230 13:47841824-47841846 CTCCCCTGTTACTGCTTCCTAGG - Intergenic
1108931591 13:55830093-55830115 CTCCCCTATTAAGTTTTCTTGGG - Intergenic
1112167657 13:96936752-96936774 GTCCCCAGTTATGGATTTTTAGG - Intergenic
1113372064 13:109733462-109733484 TTCCTCAGTCAAGGCTTCTTTGG - Intergenic
1113597194 13:111541588-111541610 CGCCCCAGCCCAGGCTTCTTCGG + Intergenic
1117308470 14:54498921-54498943 TTCCCCAGACAAGGCTTCATTGG + Intergenic
1118353732 14:64993402-64993424 AACCTCAGTTAAGGCTGCTTTGG - Intronic
1118440866 14:65810439-65810461 TTCCCCAGCAAAGGCTGCTTAGG - Intergenic
1118980670 14:70713712-70713734 CTCCCCACTTAGGGCTTCCAAGG + Intergenic
1121318348 14:92975331-92975353 CTCCGACATTAAGGCTTCTTGGG + Intronic
1122408352 14:101513468-101513490 CTCCCCAGTGAAAGCCTCTGAGG + Intergenic
1125612863 15:40983998-40984020 CTTCACAGTTGAGGCTGCTTTGG + Intronic
1127823716 15:62684216-62684238 TTCCCCAGTGAGGGCTTCTGGGG - Intronic
1128729447 15:70010866-70010888 CCCCCTGGTTAATGCTTCTTTGG + Intergenic
1128940809 15:71786283-71786305 CACCCCAGTTAATTCTTATTAGG - Intergenic
1129338276 15:74867362-74867384 CTCTTCCGTTAAGTCTTCTTTGG - Intronic
1136551405 16:30984393-30984415 CTCCCCAGTTTAGGGGTCTCTGG + Exonic
1136748950 16:32615952-32615974 CCCCCCAGTTCAGGCCTCCTGGG + Intergenic
1139292143 16:65868709-65868731 CTTCCCAGTGAATGCTTCCTTGG - Intergenic
1139334334 16:66220667-66220689 CTCCCCATCTGGGGCTTCTTGGG - Intergenic
1141270114 16:82531868-82531890 CCCTCCAGTTTAGGCTTATTTGG + Intergenic
1141480062 16:84300436-84300458 CTCCCCAGCTGGGGCTTCCTGGG + Intronic
1142377215 16:89712215-89712237 GTCCCCAGGTAAGGCTTCTGGGG + Intronic
1203051083 16_KI270728v1_random:875166-875188 CCCCCCAGTTCAGGCCTCCTGGG + Intergenic
1142899332 17:3002630-3002652 CTCCCCAGTGGAGGCCTCCTGGG - Intronic
1148453998 17:47801140-47801162 CTCCCCAGTTAAGGAGGCTCAGG - Intergenic
1149393693 17:56217804-56217826 TTCCCCAGTTAAGGGGTTTTGGG + Intronic
1154090860 18:11361678-11361700 CTCCCCAGTTCAGGTATATTTGG - Intergenic
1156558069 18:38089836-38089858 ATCCCCAGATAAGCCTTCCTGGG + Intergenic
1157740754 18:50090613-50090635 CTACCCTTTTTAGGCTTCTTGGG + Intronic
1162349968 19:10142682-10142704 CTCCCCAGTTAGGGAGTCATAGG + Intronic
1166120814 19:40685144-40685166 GTCCCCAGGCAAGGCTTCTGGGG + Intronic
1166575701 19:43835497-43835519 CTCCCCAGTTCTGGCTTTTCTGG + Exonic
1167367080 19:49060190-49060212 CTCCCCCATTCAGGCTTCTGGGG + Intronic
1168394110 19:56033608-56033630 CTCCCAAGTTGAGGGATCTTAGG - Exonic
929894938 2:45951476-45951498 CTCCTGAGTCAAGGCTTCTCTGG + Intronic
932469243 2:71943184-71943206 CTCCTCCGGGAAGGCTTCTTTGG + Intergenic
939507719 2:143069968-143069990 CTTCCCTGTTAAAGCTGCTTTGG + Intergenic
941136992 2:161729968-161729990 CGGCCAAGATAAGGCTTCTTGGG + Intronic
945431779 2:209772605-209772627 CTCCCCAGTTAAATCTCCTGAGG + Intronic
947242529 2:228011614-228011636 CTCTCCAGATAAGGGTTCTTAGG + Intronic
947642259 2:231713748-231713770 CTCCCCAGTTAAGGCTTCTTGGG - Intergenic
1169800492 20:9507730-9507752 CTCCACCGCTAAGGCTGCTTGGG - Intergenic
1169933269 20:10856616-10856638 CTCCTCAGTAAAGTCTTCTCTGG - Intergenic
1170848596 20:19982989-19983011 CTCCCCAGTCAGTGCTTCCTGGG + Intronic
1171216379 20:23355617-23355639 TTCCCCAGTTAAGTTGTCTTTGG + Intergenic
1172037138 20:32018612-32018634 GTCCCCAGTTAAGGCTCCCTTGG + Intronic
1174540561 20:51285996-51286018 CCCCACAGTAAAGGCTTCTGGGG + Intergenic
1178243134 21:30925630-30925652 CTCCCCAGTTGAGACTGGTTTGG + Intergenic
1181544630 22:23594971-23594993 TTCCCCAGTTAGGGTTTCCTGGG - Intergenic
1181815683 22:25434924-25434946 TTCCCCAGTTAGGGTTTCCTGGG + Intergenic
1182787653 22:32920922-32920944 CTCCCCAGTTATAGCTTCAATGG + Intronic
1183328393 22:37206580-37206602 CTCCCCAGTGGAAGCCTCTTGGG + Exonic
1184248210 22:43246230-43246252 CTCCTCAGTGAAGGGTGCTTAGG + Intronic
1184513931 22:44948954-44948976 CTTCCCAGTTTGGGGTTCTTTGG + Intronic
950408741 3:12820666-12820688 CCTCCCAGTGAAGGCTGCTTGGG - Intronic
952037203 3:29217052-29217074 CTCTCTACTTAAGGCTTCATGGG - Intergenic
952288674 3:31993966-31993988 TTCCCCAGTTGAGGGATCTTTGG - Intronic
952956859 3:38562985-38563007 TTCCCCAAAAAAGGCTTCTTTGG - Intronic
953027232 3:39152318-39152340 CTCCCTACTTAAGCCTTCTGTGG - Intronic
953827585 3:46267493-46267515 CTGCCTAGTTATGGCTTCTAGGG + Intergenic
955202616 3:56864419-56864441 TTCCCCAGAAAAGGCTTCCTTGG + Intronic
955275417 3:57542612-57542634 CTCCACAGTTAAAACTTTTTAGG + Intronic
958659690 3:97050279-97050301 CTTCCTAGTCAAGGCTTCTTGGG - Intronic
961591627 3:127985729-127985751 CTCCCGAGTTGAGCCTACTTGGG - Exonic
962371225 3:134822317-134822339 CTCCCCAGCCTAGGCTTCCTGGG + Intronic
973918184 4:55657626-55657648 GTCCTCAGTTAAGGGTTCTCAGG + Intergenic
976345504 4:83994857-83994879 CCACTTAGTTAAGGCTTCTTGGG + Intergenic
976437573 4:85035520-85035542 CTCCTAATTCAAGGCTTCTTAGG + Intergenic
980743896 4:136990219-136990241 CTCTCCAGTTAAGGCTGCTATGG + Intergenic
980983050 4:139670359-139670381 CCACCCACTGAAGGCTTCTTGGG - Intronic
987402130 5:17488817-17488839 ATCCCCACTTCAGGCTACTTGGG - Intergenic
991923198 5:71678331-71678353 CTCCTCAGTGAAGTCTTCTCAGG + Intergenic
992501782 5:77350559-77350581 CCCCCCAGCCAAGGCTTCTCGGG - Intronic
998081378 5:139277673-139277695 CTCTCCAGATAAGGGTCCTTAGG + Intronic
998445846 5:142197811-142197833 CTACCCGGTAAAGACTTCTTGGG + Intergenic
1002160975 5:177313927-177313949 TTCCCCAGTAAAGCCTTCTCTGG - Intergenic
1002471123 5:179436798-179436820 CTCCCCAGCTAGGGCCTCGTTGG + Intergenic
1005002854 6:21260140-21260162 TTCCCCGTTTAAGGCTTTTTTGG + Intergenic
1015884366 6:137901283-137901305 CTTTCCAGGTAAGCCTTCTTGGG - Intergenic
1019349028 7:544536-544558 CACCCCAGGTAAGACTTCCTGGG + Intergenic
1019761253 7:2814531-2814553 CTTCCCAGTAAAGACTTCATGGG - Intronic
1020055045 7:5111935-5111957 CTAGCCAGGTAAGGCTTCTGAGG + Intergenic
1020737010 7:11963573-11963595 CTGCCCAGTTAACAATTCTTGGG + Intergenic
1022155998 7:27662610-27662632 CTCCCGAGAAAAGACTTCTTCGG + Intronic
1030033131 7:105387843-105387865 CTCTCCAGGAAAGGGTTCTTGGG + Intronic
1030069771 7:105688636-105688658 CTTCCCAGACAAGGCTTCATTGG - Intronic
1032322145 7:130895356-130895378 CTCCCCAATGAAGACTTCTGTGG - Intergenic
1033768330 7:144520083-144520105 CTCCACAGTTGAGGTCTCTTCGG + Intronic
1034024361 7:147682846-147682868 GTGCCCAGTTAAGGTTTTTTGGG + Intronic
1037059920 8:14495046-14495068 CTCCCCAGTTGATTCTTCATGGG + Intronic
1037739020 8:21590486-21590508 CTCCACAGTTAATGCTTCCAGGG - Intergenic
1038753642 8:30320034-30320056 CTCCTTAGTTACGGCTTCCTAGG + Intergenic
1042091612 8:65165356-65165378 CTCCCCATTTAAGGCTCCCTTGG - Intergenic
1046500214 8:115066786-115066808 CTGCTCAGATAAGGATTCTTGGG - Intergenic
1046898024 8:119494239-119494261 TACCCCAGTTATGGCTTCTAGGG - Intergenic
1048951720 8:139502038-139502060 CGCCCCAGCTGAGGCTGCTTTGG + Intergenic
1052976184 9:34412078-34412100 CTCCCTGCTTAAGGCTTCATTGG - Intronic
1059791358 9:117644775-117644797 CTTCCCATTTAAGGTTTCATTGG + Intergenic
1059985682 9:119818197-119818219 CTTCCCAGTCTAGGCTTGTTGGG - Intergenic
1061179362 9:129014640-129014662 CTCCCCAGAGAGGGCTCCTTTGG - Intronic
1185430904 X:11193-11215 TTCCCCAGCTATGGCTTCTTGGG + Intergenic
1185440170 X:223590-223612 TTCCCCAGCTATGGCTTCTTGGG + Intergenic
1189792292 X:44615502-44615524 ACATCCAGTTAAGGCTTCTTAGG - Intergenic
1191862837 X:65679890-65679912 CTACCCAACTAAGGCTTCTCTGG - Intronic
1192972923 X:76252729-76252751 TTCCCCAATTCAGGCTTCCTAGG - Intergenic
1196437764 X:115690527-115690549 CTCCACACTTAAGTCTTCTAAGG - Intergenic