ID: 947645161

View in Genome Browser
Species Human (GRCh38)
Location 2:231733534-231733556
Sequence GGGGCCACTCACTTGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947645161_947645170 7 Left 947645161 2:231733534-231733556 CCATGTGCCAAGTGAGTGGCCCC 0: 1
1: 0
2: 0
3: 14
4: 198
Right 947645170 2:231733564-231733586 CCTGGCAAAAGGGTGAACAGAGG 0: 1
1: 0
2: 1
3: 16
4: 164
947645161_947645167 -3 Left 947645161 2:231733534-231733556 CCATGTGCCAAGTGAGTGGCCCC 0: 1
1: 0
2: 0
3: 14
4: 198
Right 947645167 2:231733554-231733576 CCCTCACTCACCTGGCAAAAGGG 0: 1
1: 0
2: 0
3: 24
4: 164
947645161_947645165 -4 Left 947645161 2:231733534-231733556 CCATGTGCCAAGTGAGTGGCCCC 0: 1
1: 0
2: 0
3: 14
4: 198
Right 947645165 2:231733553-231733575 CCCCTCACTCACCTGGCAAAAGG 0: 1
1: 0
2: 1
3: 24
4: 282
947645161_947645171 19 Left 947645161 2:231733534-231733556 CCATGTGCCAAGTGAGTGGCCCC 0: 1
1: 0
2: 0
3: 14
4: 198
Right 947645171 2:231733576-231733598 GTGAACAGAGGATGTAACTTAGG 0: 1
1: 0
2: 0
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947645161 Original CRISPR GGGGCCACTCACTTGGCACA TGG (reversed) Intronic
900977721 1:6027449-6027471 AGGGCCGCTCACCTGGCACTGGG - Intronic
901007444 1:6178950-6178972 GAGGCCACAGACTTGGCGCAGGG + Intronic
902723681 1:18321580-18321602 GGGGCCCACTACTTGGCACATGG + Intronic
903485857 1:23688960-23688982 GGGGCTCCTCACTTCGCAGACGG - Intergenic
904833699 1:33321321-33321343 GGGGCCAATCACCTGGAAGAGGG + Intergenic
905644528 1:39616183-39616205 GGGCCCAGTCATATGGCACAAGG - Intergenic
905673459 1:39808305-39808327 GGGGCTCCTCACTTGGCAGACGG - Intergenic
905682831 1:39886521-39886543 GGGGTCACTCCTTTGGCCCAGGG - Intergenic
906657058 1:47556004-47556026 GGCGCCACTCACATCACACACGG + Intergenic
912700877 1:111877471-111877493 GGGACCACTCACTTCCTACATGG + Intronic
913286945 1:117235308-117235330 GAGGCGACTCACTTGTCAAATGG + Intergenic
913317900 1:117567775-117567797 GGGGGCAGTGACATGGCACAGGG - Intergenic
915861614 1:159450046-159450068 GGGGCTCCTCACTTCCCACAAGG - Intergenic
916087380 1:161281390-161281412 GGGGCTCCTCACTTCCCACAAGG + Intronic
919890159 1:201966424-201966446 GAGGCCACTCACTTGACCCCAGG + Intronic
920037362 1:203075040-203075062 GGGGTCACTCACCTGGTACAGGG + Intronic
920082508 1:203385602-203385624 GGGGCCATCAACATGGCACAGGG - Intergenic
920143895 1:203841823-203841845 GGGGCTCCTCACTTCGCAGACGG + Intronic
920299335 1:204978803-204978825 GGGACCACTCCCTTCCCACAGGG - Intronic
924037933 1:239955098-239955120 GGGGCTAGACACCTGGCACAAGG - Intergenic
924172583 1:241357246-241357268 GGGGACAGTCACGTGGGACAGGG + Intergenic
1062898367 10:1122349-1122371 GGGGTCACTCACTCTGTACAGGG - Intronic
1066374419 10:34844467-34844489 GGTACCACCCTCTTGGCACATGG - Intergenic
1069557279 10:69406615-69406637 GGTGCCATTCACTTGGCTCCAGG + Intronic
1070791870 10:79194513-79194535 GGGGCTCCTCACTGGACACAGGG - Intronic
1078225091 11:9384689-9384711 AGCGCCACTCACTGCGCACATGG - Exonic
1079407909 11:20161552-20161574 GGGGCCCTTAACTTGGCCCAAGG + Intergenic
1083334827 11:61916554-61916576 GGGACCACTCATCTGGCCCAGGG + Intronic
1083934526 11:65863352-65863374 GGGGCAACTGCCCTGGCACAAGG + Intronic
1085534186 11:77208258-77208280 GGGGACACTCAGCAGGCACATGG + Intronic
1088740159 11:112760672-112760694 GGGACCAATATCTTGGCACATGG + Intergenic
1089642447 11:119856756-119856778 GGGGCCACTCACCAGGGCCAGGG + Intergenic
1090355790 11:126139622-126139644 GGAGCCAGTCACTCGGCCCACGG + Intergenic
1091263271 11:134250842-134250864 GTGGCCACTCTCTTGCTACAAGG + Intronic
1091381501 12:64850-64872 GGGCCAGCTCACTGGGCACATGG + Intergenic
1092044850 12:5424019-5424041 CAGGACACTCACTTGGCACATGG - Intergenic
1092843820 12:12566141-12566163 GGGGCTCCTCACTTCGCAGACGG - Intergenic
1093038512 12:14354805-14354827 GGGGCTCCTCACTTGTCAGACGG - Intergenic
1096555888 12:52403536-52403558 AGGGCACCCCACTTGGCACACGG - Intronic
1096856676 12:54488506-54488528 GGGGCCCCTCACTTCTCAGACGG + Intergenic
1097179343 12:57162454-57162476 GGGGCCGCTCACTGCGCAGAAGG - Exonic
1098628484 12:72700999-72701021 TGGGTCCCTCACATGGCACATGG + Intergenic
1099958247 12:89372029-89372051 GGGGCCCTTCACTTGCCTCAAGG - Intergenic
1101739667 12:107491184-107491206 GGAGCCATTCACTTGGCTGATGG - Intronic
1103408562 12:120693953-120693975 GGGGCCACCCACTCTGCACCTGG - Intronic
1103551939 12:121744342-121744364 AGGGCCACAGACTTAGCACACGG - Intronic
1103791836 12:123477695-123477717 GGGCCCATTCACTTAGCAGAAGG - Intronic
1106606276 13:31232081-31232103 GGTGCAACTGTCTTGGCACAAGG - Intronic
1107562703 13:41572119-41572141 GGGGCTCCTCACTTCGCAGACGG - Intronic
1108741572 13:53344073-53344095 GGTGCCACTAACTTTACACAAGG + Intergenic
1113928340 13:113953237-113953259 GTGGCCACTCACATCCCACAGGG + Intergenic
1115271647 14:31560075-31560097 GGGGCCCCTCACTTCCCAGACGG + Intronic
1115547519 14:34476359-34476381 GGGGCCCCTCACTTCCCAGACGG - Intergenic
1116951870 14:50885874-50885896 GGGGCCACTCTCTGGGTACAGGG + Exonic
1119722038 14:76898172-76898194 GGGGCTCCTCACTTCGCAGACGG + Intergenic
1121446088 14:93980193-93980215 GGGGTCCCTAACTTTGCACAAGG + Intergenic
1121921880 14:97889352-97889374 GGGGCCTCTCCCATGACACATGG + Intergenic
1122347697 14:101070775-101070797 CTGGTCACTCACTTGGCCCAGGG - Intergenic
1122406079 14:101501907-101501929 TGGGCCAGGCACTTGGCACAGGG + Intergenic
1126069217 15:44851102-44851124 GGGGCCCCTCAAATGCCACATGG - Intergenic
1126089596 15:45039670-45039692 GGGGCCCCTCAAATGCCACATGG + Intronic
1128308584 15:66616291-66616313 AGGACCACACAGTTGGCACAAGG - Intronic
1129263613 15:74382477-74382499 GGGGCCAATCAGCTGGCACTGGG + Intergenic
1131171791 15:90184425-90184447 GGAGGCACACACCTGGCACATGG - Intronic
1132043941 15:98548534-98548556 GGGGCCGCTCCCGAGGCACAAGG + Intergenic
1132569438 16:637646-637668 AGGGCCAGTCACGTGGCTCAGGG + Intronic
1133050737 16:3115910-3115932 AGGGCCACTCACCTGGGACCAGG - Exonic
1135472338 16:22742565-22742587 GGGGCCAAGCATTTGGCAGAGGG + Intergenic
1136687435 16:32003478-32003500 GGAGGCACTCACTGGGCCCAGGG + Intergenic
1136788049 16:32947029-32947051 GGAGGCACTCACTGGGCCCAGGG + Intergenic
1136881736 16:33906760-33906782 GGAGGCACTCACTGGGCCCAGGG - Intergenic
1137430782 16:48416731-48416753 GGGGCCCCTCACTTCCCAGACGG + Intronic
1140281711 16:73560617-73560639 TGGGCCACTCCCTTCGCACCTGG - Intergenic
1140687108 16:77444091-77444113 GCGGAAACTCACTAGGCACAGGG - Intergenic
1140840692 16:78836330-78836352 GGGGCCACTGGCTTTGCAAATGG - Intronic
1140864723 16:79050112-79050134 TGAGCCACTCAGTTGCCACACGG - Intronic
1141187534 16:81798552-81798574 GGGGCCACTCCACTGTCACAGGG + Intronic
1141508304 16:84495595-84495617 GAGGCCAGTTACATGGCACATGG - Intronic
1142113586 16:88344925-88344947 GGGGCCACACGCTTGACACCTGG - Intergenic
1203090274 16_KI270728v1_random:1208686-1208708 GGAGGCACTCACTGGGCCCAGGG + Intergenic
1143182825 17:4994382-4994404 GGGAGGACTCACTTGGCAAAGGG + Exonic
1143667774 17:8374072-8374094 GGGGCCCCTCACTTCCCAGACGG - Intronic
1144314625 17:14048252-14048274 GAGGCCATTCTCTTGGCACAAGG + Intergenic
1145270371 17:21401572-21401594 GGGGCCTCTCATTTGACAAATGG + Intronic
1145772394 17:27502820-27502842 GGAGCCACTCGCTTGGCCCAAGG - Intronic
1147148415 17:38499147-38499169 GGAGGCACTCACTGGGCCCAGGG + Intronic
1148854195 17:50569793-50569815 GGGGTCACTCACTGGGCACCCGG - Exonic
1149650439 17:58273042-58273064 GGGGCCACCACCTTGGCACCAGG - Intronic
1151163935 17:72188332-72188354 GAGGTCACTCAGTTGGCAGATGG + Intergenic
1156253963 18:35377396-35377418 GTGGCCGCGCACTTGGGACAGGG + Intergenic
1156451971 18:37271850-37271872 GGTTCCACCCACTTGGCATAGGG - Intronic
1161384400 19:3983323-3983345 GGAGCCACACACCTGGCCCAGGG + Intronic
1162945234 19:14039422-14039444 GCAGCCACTCTGTTGGCACAAGG + Intronic
1165720838 19:38078723-38078745 TGGGCCACGCACTTGGTTCAAGG - Intronic
1167266537 19:48485606-48485628 GGGGCCTCCCGTTTGGCACATGG + Exonic
1168113677 19:54209127-54209149 GGGGCCCCTCACTTGCAACCAGG + Intronic
925694338 2:6559612-6559634 GTGACCACTCATTTGTCACATGG + Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
932718952 2:74124071-74124093 GGGGCTCCTCACTTCGCAGATGG - Intergenic
933997817 2:87682807-87682829 GCAGCCACCCACTCGGCACATGG - Intergenic
934026263 2:88003608-88003630 GGGGCCCCTTTCTTGGCACGCGG + Intergenic
934761629 2:96859960-96859982 GGGGCCTCCCACTTGGCCCCGGG - Exonic
936045943 2:109188056-109188078 GGGACCACTCACTACGCTCACGG - Intronic
936296035 2:111268059-111268081 GCAGCCACCCACTCGGCACATGG + Intergenic
938342301 2:130543871-130543893 GAGCCCACTCACTCGGCAAATGG + Exonic
938347531 2:130576838-130576860 GAGCCCACTCACTCGGCAAATGG - Exonic
947533740 2:230928187-230928209 GGGAACACACGCTTGGCACAGGG + Intronic
947645161 2:231733534-231733556 GGGGCCACTCACTTGGCACATGG - Intronic
947814648 2:233028303-233028325 GGGTCCACTCAGTTGGCTGAGGG - Intergenic
1168774364 20:435616-435638 TGCGCCACCCTCTTGGCACATGG + Exonic
1171463016 20:25309445-25309467 GGGGCCACTCTCTGGGCACTGGG - Exonic
1172386698 20:34538985-34539007 TGGGCCACCCACTTCTCACACGG - Intronic
1172768774 20:37364872-37364894 GGGGCCACATTCTTGGCAAAGGG - Intronic
1175972965 20:62696428-62696450 CTGGTCTCTCACTTGGCACATGG - Intergenic
1176283706 20:64329984-64330006 GGGCCAGCTCACTGGGCACATGG - Intergenic
1177816339 21:25981134-25981156 GGGGCCATTCATTTGGCCCTGGG + Intronic
1177899676 21:26898940-26898962 GTGGTCTCTCACTTGACACATGG + Intergenic
1178880715 21:36448002-36448024 TGGGGCACACACATGGCACATGG + Intergenic
1179158177 21:38869325-38869347 GGGGCCCCTCAGTTGGCCCTGGG + Intergenic
1179343882 21:40538099-40538121 GGGGCCACTCAGTTGGGTAAAGG + Intronic
1180796412 22:18607951-18607973 GGTGCCCCTCACGTGGCAGAAGG - Exonic
1180861284 22:19084452-19084474 GGGGCCCCTCACTTCTCAGACGG - Intronic
1181225311 22:21387320-21387342 GGTGCCCCTCACGTGGCAGAAGG + Exonic
1181253322 22:21547493-21547515 GGTGCCCCTCACGTGGCAGAAGG - Exonic
1181567899 22:23750969-23750991 GGGGCCACTCACCTGGGCCGGGG + Exonic
1182648835 22:31834059-31834081 AGGACCACTCACTTCCCACAGGG - Intronic
1183062051 22:35342294-35342316 GGGGCCTGGCACATGGCACAGGG - Intronic
1185150280 22:49160361-49160383 GGTGCCACACACTTGGCCCCTGG - Intergenic
950363667 3:12468066-12468088 GGGTCCCCTGACTTCGCACAAGG - Intergenic
950460594 3:13120062-13120084 GAAGGCACTCACCTGGCACAGGG + Intergenic
951891982 3:27576012-27576034 GGGGACATTCTCTTGGCACATGG + Intergenic
953322293 3:41983309-41983331 GGGGCTTCTCACTTGTCAGACGG + Intergenic
954713600 3:52516577-52516599 GGGCCCACTCACTTGGCATTGGG - Exonic
955336773 3:58093280-58093302 TGGGCCATCCTCTTGGCACATGG + Intronic
956742348 3:72285099-72285121 GGGGCCACCCAGTTGGGAAATGG - Intergenic
960450506 3:117801156-117801178 GGGGCCACTCAGATAGAACAAGG - Intergenic
961733359 3:128984052-128984074 GGGGACACCCACTGGGCACCAGG + Intronic
964412985 3:156418633-156418655 GGTGCCACTCACTTTGCAGCTGG - Intronic
967364821 3:188674118-188674140 GTGGCCACTCAATAGGCAGAAGG - Intronic
967588270 3:191240714-191240736 TGGCCCACTCACTTGGCTGAAGG + Intronic
968569016 4:1329668-1329690 GGAGCCACCCACAAGGCACACGG + Intronic
968794923 4:2696994-2697016 GGGGCGGGGCACTTGGCACAGGG + Intronic
969422514 4:7105484-7105506 GGGGCCAGACACCTGGCAAATGG - Intergenic
973263387 4:48186667-48186689 GGGGCTCCTCACTTCGCAGACGG - Intronic
975404154 4:73969509-73969531 CCCGCCACTCACTTGTCACAAGG + Intergenic
977050351 4:92121408-92121430 GTGGCCACACACTTGGCAGCTGG - Intergenic
977542098 4:98330368-98330390 GGGGCTCCTCACTTCTCACACGG + Intronic
978282565 4:107035668-107035690 GGGGCCCCTCACTTGGGTCGCGG + Exonic
980517141 4:133878015-133878037 TGGGGCAGTCACTTGGCACAGGG - Intergenic
981559048 4:146027020-146027042 AGGTCCACTGACTTGTCACATGG - Intergenic
982483884 4:155944125-155944147 TGAGACACTCACTTAGCACATGG + Intronic
983111685 4:163758170-163758192 TGGGCCAGTCACTTGGCTGAGGG + Intronic
983628744 4:169828458-169828480 GGGGCTCCTCACTTCGCAGACGG - Intergenic
983664386 4:170166182-170166204 GGGGCCCCTCACTTCCCAGATGG + Intergenic
984813652 4:183818644-183818666 GGGGCCCCTCACTTCCCAGAAGG + Intergenic
985580624 5:693644-693666 GGGGCCCCTCACCTGGCTCTGGG + Intergenic
991566549 5:68010840-68010862 GTGGCCATTCCCATGGCACAAGG + Intergenic
992415730 5:76550900-76550922 GGGGCTCCTCACTTCCCACACGG + Intronic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
996127150 5:119739322-119739344 GGGAGAACTCACCTGGCACAAGG + Intergenic
997261992 5:132472362-132472384 GGAGCCACACACTGGGCTCAAGG - Intronic
999330714 5:150671898-150671920 GAGGCCACTCACCTGGCGCCAGG - Exonic
999914868 5:156247315-156247337 GGGGCTCCTGACTTGGCTCAAGG + Intronic
1000630226 5:163583769-163583791 GGGGCTCCTCACTTCGCAGACGG + Intergenic
1000651684 5:163825966-163825988 AGGGACACTTCCTTGGCACAGGG - Intergenic
1000920662 5:167133070-167133092 GGAGCCACTCACACAGCACAAGG + Intergenic
1000942199 5:167375285-167375307 AGGGCTACTCCCTTAGCACAGGG + Exonic
1001153164 5:169249805-169249827 GGGGCAAAAGACTTGGCACAGGG + Intronic
1003162336 6:3646789-3646811 CCGGCCACCCACTTCGCACATGG - Intergenic
1004487952 6:16085637-16085659 GGGGTCCCTCGCATGGCACATGG - Intergenic
1006367595 6:33624690-33624712 GGGCCCACACACTGGGCACTGGG - Intronic
1010005390 6:70990454-70990476 GGGGTCCCTCCCTTGCCACATGG - Intergenic
1015941281 6:138454887-138454909 GATGCCAAGCACTTGGCACATGG - Intronic
1016236581 6:141875216-141875238 AGGTCCATTCACTGGGCACAGGG + Intergenic
1017623097 6:156318605-156318627 GGGGCCTCTCCCGTGCCACAGGG - Intergenic
1019196119 6:170284011-170284033 AGGTCCACACACTTGGCACCTGG + Exonic
1019749251 7:2718528-2718550 GCGCCCACTCACCTGGCACGTGG + Intronic
1019881778 7:3867515-3867537 GGGGCCAGTCACTTCTTACATGG + Intronic
1019884736 7:3893848-3893870 TGGGCCACCCACTTGCCACTTGG + Intronic
1022472134 7:30688574-30688596 GGGGCCACTGCCAGGGCACAAGG - Intronic
1029421245 7:100472829-100472851 GGGGCCACTCGCTGGGATCAGGG - Intronic
1029540622 7:101180117-101180139 GGGACCTCTCTCTTGGCACCGGG - Exonic
1032789727 7:135233489-135233511 GGTTCCACTCACCTGGCACTGGG - Intronic
1034267610 7:149788835-149788857 GTGCCCATTCTCTTGGCACAGGG - Intergenic
1034268569 7:149792605-149792627 GGGCCCAGGCACTTGGCCCAGGG - Intergenic
1034548861 7:151807695-151807717 CGGGCCCCTCACTTGGGTCAAGG + Intronic
1035389262 7:158494832-158494854 AGCACCACTCACTTGGTACAAGG + Intronic
1042876815 8:73448070-73448092 GGGTCCAGTCACTTTGCACCCGG - Intronic
1045709397 8:104965282-104965304 AGAGCCAGTCACATGGCACAGGG + Intronic
1049204926 8:141359240-141359262 GGGGCCACGCACTGGTCAGAGGG - Intronic
1049410175 8:142470466-142470488 GGAGCCACTCCTTTTGCACAAGG + Intronic
1049622058 8:143602894-143602916 GAGGCCACTGCCTTGGCCCAAGG + Exonic
1051853062 9:21531527-21531549 GAGGAGACTCAGTTGGCACAAGG - Intergenic
1055894245 9:81157381-81157403 GGTGCCACCCACTGGGCAAAGGG - Intergenic
1056576108 9:87857286-87857308 GGCGCTCCTCACTTGGCAGAGGG + Intergenic
1056634458 9:88320271-88320293 GGGGCAAGTCACTCGGCAGAAGG - Intergenic
1056724692 9:89104503-89104525 GGGCACTCTGACTTGGCACAAGG - Intronic
1057197051 9:93121075-93121097 GGGGACATTCTCTGGGCACAGGG - Intergenic
1057443314 9:95097292-95097314 GGGGCCAAACACTGGGCAAATGG - Intergenic
1057630425 9:96715581-96715603 GGGGCCCCTCACTTCCCAGACGG + Intergenic
1060475560 9:123984047-123984069 AGGGCCAGCCACTTGTCACACGG - Intergenic
1061444173 9:130628463-130628485 GAGGTCACTAGCTTGGCACATGG - Intronic
1062194507 9:135265450-135265472 GAGGCCACTCACGTGGCAGAGGG + Intergenic
1062495576 9:136830037-136830059 GCGGACGCACACTTGGCACAAGG + Intronic
1062549581 9:137079791-137079813 GGTGCCTGGCACTTGGCACAGGG + Intronic
1186559434 X:10595138-10595160 AGGGCCACACAACTGGCACATGG + Intronic
1187043361 X:15620413-15620435 GGGGCCACTCAGTTAGTAAATGG + Intergenic
1187184322 X:16968949-16968971 GGGGCCCCTCACTTCTCAGACGG + Intronic
1192563393 X:72142630-72142652 GGGGCCTCTCACTCGGCACCTGG - Intergenic
1195091739 X:101466945-101466967 GATGCCACCCAGTTGGCACATGG - Intronic
1195149978 X:102057459-102057481 TGGGCCCCTCTCTTGACACATGG - Intergenic
1200387425 X:155907822-155907844 GGGGCTCCTCACTTCGCAGACGG + Intronic
1200527806 Y:4295690-4295712 GGGGCCCCTCACTTCTCAGATGG - Intergenic