ID: 947658805

View in Genome Browser
Species Human (GRCh38)
Location 2:231851248-231851270
Sequence CGGTGCTGCAGCGGAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947658799_947658805 12 Left 947658799 2:231851213-231851235 CCAGTGACTGAGAGGACGAGTGT No data
Right 947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947658805 Original CRISPR CGGTGCTGCAGCGGAGGAGA TGG Intergenic
No off target data available for this crispr