ID: 947660409

View in Genome Browser
Species Human (GRCh38)
Location 2:231862257-231862279
Sequence CTGTGGTTGAAGAAGCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947660400_947660409 22 Left 947660400 2:231862212-231862234 CCTGGTACAGGTCTGCAGGGGGC No data
Right 947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG No data
947660406_947660409 0 Left 947660406 2:231862234-231862256 CCTAGGGGTCGGCCAAGGAAATG No data
Right 947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG No data
947660395_947660409 29 Left 947660395 2:231862205-231862227 CCACTGGCCTGGTACAGGTCTGC No data
Right 947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947660409 Original CRISPR CTGTGGTTGAAGAAGCCTCC TGG Intergenic
No off target data available for this crispr