ID: 947661633

View in Genome Browser
Species Human (GRCh38)
Location 2:231873854-231873876
Sequence ATACCACTTCACAACGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947661629_947661633 11 Left 947661629 2:231873820-231873842 CCAACAGGGCAATGCAAGTCAAA No data
Right 947661633 2:231873854-231873876 ATACCACTTCACAACGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947661633 Original CRISPR ATACCACTTCACAACGGGAA TGG Intergenic
No off target data available for this crispr