ID: 947663959

View in Genome Browser
Species Human (GRCh38)
Location 2:231891338-231891360
Sequence CTGGCCGCACAGGTGTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947663950_947663959 25 Left 947663950 2:231891290-231891312 CCCAGAGAGAGAAAGAGTTAAGC 0: 39
1: 43
2: 21
3: 52
4: 353
Right 947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG No data
947663954_947663959 -4 Left 947663954 2:231891319-231891341 CCCTGAAGGCAGTGGAGAGCTGG No data
Right 947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG No data
947663956_947663959 -5 Left 947663956 2:231891320-231891342 CCTGAAGGCAGTGGAGAGCTGGC No data
Right 947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG No data
947663951_947663959 24 Left 947663951 2:231891291-231891313 CCAGAGAGAGAAAGAGTTAAGCT 0: 41
1: 44
2: 25
3: 33
4: 270
Right 947663959 2:231891338-231891360 CTGGCCGCACAGGTGTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947663959 Original CRISPR CTGGCCGCACAGGTGTGCAT GGG Intergenic
No off target data available for this crispr