ID: 947664293

View in Genome Browser
Species Human (GRCh38)
Location 2:231893787-231893809
Sequence AGTAGGACTCAGCAGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947664290_947664293 4 Left 947664290 2:231893760-231893782 CCACGGGGATTGTGGAGTTTGTT No data
Right 947664293 2:231893787-231893809 AGTAGGACTCAGCAGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947664293 Original CRISPR AGTAGGACTCAGCAGAAACC TGG Intergenic