ID: 947669372

View in Genome Browser
Species Human (GRCh38)
Location 2:231926623-231926645
Sequence GGGCGCGCGCTCGCTGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947669372_947669378 4 Left 947669372 2:231926623-231926645 CCATTTGCAGCGAGCGCGCGCCC 0: 1
1: 0
2: 0
3: 6
4: 27
Right 947669378 2:231926650-231926672 CTGCCGAGCATCGGTGCGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 71
947669372_947669381 24 Left 947669372 2:231926623-231926645 CCATTTGCAGCGAGCGCGCGCCC 0: 1
1: 0
2: 0
3: 6
4: 27
Right 947669381 2:231926670-231926692 TGGTGCCCTGTGCACCCACTAGG 0: 1
1: 0
2: 2
3: 15
4: 139
947669372_947669374 -5 Left 947669372 2:231926623-231926645 CCATTTGCAGCGAGCGCGCGCCC 0: 1
1: 0
2: 0
3: 6
4: 27
Right 947669374 2:231926641-231926663 CGCCCTGGCCTGCCGAGCATCGG 0: 1
1: 0
2: 0
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947669372 Original CRISPR GGGCGCGCGCTCGCTGCAAA TGG (reversed) Intergenic
900556463 1:3283291-3283313 GGGCCCGGGGTGGCTGCAAATGG + Intronic
903813216 1:26046217-26046239 GGGCGGTCGCCGGCTGCAAAAGG + Intergenic
919809542 1:201399832-201399854 GGGAGGGCGCTCCCTGCGAAGGG - Intergenic
1065090582 10:22229200-22229222 CGGCGGGCGCGCGCGGCAAACGG + Intergenic
1065115116 10:22476983-22477005 GGGCCTGCGCTCGCTGGAAGCGG - Intergenic
1067562416 10:47313144-47313166 GGGCGCTCGCTCCCTGCACACGG + Exonic
1069430878 10:68332700-68332722 GGGCGCGCTCCCGATGGAAATGG + Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1094317561 12:29149675-29149697 GGGCGCGCGGGGGTTGCAAAGGG + Intronic
1112041448 13:95552511-95552533 GGGCGCGGGCCAGCTGCAGATGG + Intronic
1143669117 17:8384010-8384032 AGCCGTGCGCTCCCTGCAAATGG + Intergenic
1147311613 17:39599149-39599171 GAGCGCGAGTTCGCTGCAAGCGG + Intergenic
1147970789 17:44218547-44218569 GGGCGGGCGCTCGCTGCACGCGG - Intronic
1152084773 17:78211393-78211415 GGGCCCAGGCTCGCTGCAGATGG + Intergenic
1160861758 19:1240172-1240194 GGGCTCGGGCTCCCTGGAAAGGG - Intergenic
1161006719 19:1940920-1940942 GGGCGCGCGCGGGCAGGAAAGGG - Intergenic
1161111960 19:2475678-2475700 GGGCGAGATCACGCTGCAAACGG + Intergenic
1162651582 19:12092623-12092645 GGGGCCGCGGTCGCTGCGAAGGG - Intronic
1167157092 19:47745496-47745518 CTGCGCGCGCACGCTGCAAAGGG + Intergenic
925376226 2:3388105-3388127 GGGCGCGCGCTGGCTGAAGATGG - Exonic
935592220 2:104854087-104854109 GGGTGCGCGCTCGCGGCGGAGGG + Intergenic
947669372 2:231926623-231926645 GGGCGCGCGCTCGCTGCAAATGG - Intergenic
1172766789 20:37355374-37355396 AGGGGGGAGCTCGCTGCAAATGG - Intronic
1183607154 22:38872420-38872442 GGGCGCGCGCTGGCTCTTAAAGG + Intergenic
1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG + Intergenic
962316766 3:134364097-134364119 GGGGGCTCGCTCGCTGCCCAAGG - Intronic
982292074 4:153790698-153790720 GGGCCCGGGGTAGCTGCAAAAGG + Intergenic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
1002508616 5:179698470-179698492 GGGCCCGCGTTCGCTGCAACGGG + Intronic
1006776159 6:36594167-36594189 CGGCGCGCGCTCGTTGTAACAGG - Intergenic
1023909735 7:44545060-44545082 GGGCCCCTGCTAGCTGCAAAGGG - Intergenic
1053198252 9:36136396-36136418 GGGCGCGCGGTCGCGGCACGAGG - Intergenic
1062049271 9:134438710-134438732 GGGTGGGCGCTGGCTGCAGAAGG - Intronic
1192216765 X:69164721-69164743 GGGCGCGTGCTCGCGACACACGG + Intronic