ID: 947671648

View in Genome Browser
Species Human (GRCh38)
Location 2:231940761-231940783
Sequence CGGGTCATGCAGGACCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947671648_947671662 28 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671662 2:231940812-231940834 GGCAGGAAGAATAGAGTGGGTGG No data
947671648_947671664 30 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671664 2:231940814-231940836 CAGGAAGAATAGAGTGGGTGGGG No data
947671648_947671654 5 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671654 2:231940789-231940811 TCCACTGTCAGATAATGTCCTGG No data
947671648_947671658 11 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671658 2:231940795-231940817 GTCAGATAATGTCCTGGGGCAGG No data
947671648_947671660 24 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671660 2:231940808-231940830 CTGGGGCAGGAAGAATAGAGTGG No data
947671648_947671657 7 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671657 2:231940791-231940813 CACTGTCAGATAATGTCCTGGGG No data
947671648_947671656 6 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671656 2:231940790-231940812 CCACTGTCAGATAATGTCCTGGG No data
947671648_947671661 25 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671661 2:231940809-231940831 TGGGGCAGGAAGAATAGAGTGGG No data
947671648_947671663 29 Left 947671648 2:231940761-231940783 CCATCCTGGTCCTGCATGACCCG No data
Right 947671663 2:231940813-231940835 GCAGGAAGAATAGAGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947671648 Original CRISPR CGGGTCATGCAGGACCAGGA TGG (reversed) Intergenic
No off target data available for this crispr