ID: 947672990

View in Genome Browser
Species Human (GRCh38)
Location 2:231952205-231952227
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947672984_947672990 8 Left 947672984 2:231952174-231952196 CCAAGAGGCTGAGGTGGGAGGAT 0: 84
1: 704
2: 1299
3: 1884
4: 5225
Right 947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
947672979_947672990 16 Left 947672979 2:231952166-231952188 CCAGCTACCCAAGAGGCTGAGGT 0: 42
1: 1630
2: 21983
3: 132613
4: 234658
Right 947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
947672977_947672990 17 Left 947672977 2:231952165-231952187 CCCAGCTACCCAAGAGGCTGAGG 0: 118
1: 6791
2: 115467
3: 221196
4: 241052
Right 947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
947672983_947672990 9 Left 947672983 2:231952173-231952195 CCCAAGAGGCTGAGGTGGGAGGA 0: 45
1: 615
2: 1823
3: 2915
4: 5667
Right 947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947672990 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intergenic
Too many off-targets to display for this crispr