ID: 947674072

View in Genome Browser
Species Human (GRCh38)
Location 2:231961690-231961712
Sequence GCTCTTCCGGGTCACGGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947674072_947674080 5 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674080 2:231961718-231961740 CCTTAGCAACTGCGGGACTGCGG 0: 1
1: 0
2: 0
3: 2
4: 112
947674072_947674081 8 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674081 2:231961721-231961743 TAGCAACTGCGGGACTGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63
947674072_947674084 22 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674084 2:231961735-231961757 CTGCGGCGGCGCCGGCCTCCGGG 0: 1
1: 1
2: 7
3: 46
4: 390
947674072_947674082 14 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269
947674072_947674078 -2 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674078 2:231961711-231961733 GCATTCTCCTTAGCAACTGCGGG 0: 1
1: 0
2: 1
3: 8
4: 120
947674072_947674083 21 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674083 2:231961734-231961756 ACTGCGGCGGCGCCGGCCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 179
947674072_947674085 23 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674085 2:231961736-231961758 TGCGGCGGCGCCGGCCTCCGGGG 0: 1
1: 1
2: 1
3: 32
4: 336
947674072_947674077 -3 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674077 2:231961710-231961732 AGCATTCTCCTTAGCAACTGCGG 0: 1
1: 0
2: 0
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947674072 Original CRISPR GCTCTTCCGGGTCACGGGCG CGG (reversed) Exonic