ID: 947674076

View in Genome Browser
Species Human (GRCh38)
Location 2:231961703-231961725
Sequence TGCTAAGGAGAATGCTCTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947674076_947674084 9 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674084 2:231961735-231961757 CTGCGGCGGCGCCGGCCTCCGGG 0: 1
1: 1
2: 7
3: 46
4: 390
947674076_947674085 10 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674085 2:231961736-231961758 TGCGGCGGCGCCGGCCTCCGGGG 0: 1
1: 1
2: 1
3: 32
4: 336
947674076_947674083 8 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674083 2:231961734-231961756 ACTGCGGCGGCGCCGGCCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 179
947674076_947674088 23 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674088 2:231961749-231961771 GCCTCCGGGGAGAAACGGTGAGG 0: 1
1: 0
2: 0
3: 11
4: 107
947674076_947674086 18 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674086 2:231961744-231961766 CGCCGGCCTCCGGGGAGAAACGG 0: 1
1: 0
2: 2
3: 11
4: 76
947674076_947674080 -8 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674080 2:231961718-231961740 CCTTAGCAACTGCGGGACTGCGG 0: 1
1: 0
2: 0
3: 2
4: 112
947674076_947674082 1 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269
947674076_947674081 -5 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674081 2:231961721-231961743 TAGCAACTGCGGGACTGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947674076 Original CRISPR TGCTAAGGAGAATGCTCTTC CGG (reversed) Exonic