ID: 947674082

View in Genome Browser
Species Human (GRCh38)
Location 2:231961727-231961749
Sequence CTGCGGGACTGCGGCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947674075_947674082 2 Left 947674075 2:231961702-231961724 CCCGGAAGAGCATTCTCCTTAGC 0: 1
1: 0
2: 1
3: 8
4: 115
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269
947674072_947674082 14 Left 947674072 2:231961690-231961712 CCGCGCCCGTGACCCGGAAGAGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269
947674074_947674082 8 Left 947674074 2:231961696-231961718 CCGTGACCCGGAAGAGCATTCTC 0: 1
1: 0
2: 1
3: 5
4: 73
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269
947674076_947674082 1 Left 947674076 2:231961703-231961725 CCGGAAGAGCATTCTCCTTAGCA 0: 1
1: 0
2: 0
3: 13
4: 157
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269
947674073_947674082 9 Left 947674073 2:231961695-231961717 CCCGTGACCCGGAAGAGCATTCT 0: 1
1: 0
2: 0
3: 3
4: 79
Right 947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG 0: 1
1: 0
2: 0
3: 24
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947674082 Original CRISPR CTGCGGGACTGCGGCGGCGC CGG Exonic