ID: 947674325

View in Genome Browser
Species Human (GRCh38)
Location 2:231963189-231963211
Sequence ACATTTAAACTACTGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947674325_947674328 -10 Left 947674325 2:231963189-231963211 CCCACCAACAGTAGTTTAAATGT 0: 1
1: 0
2: 3
3: 21
4: 205
Right 947674328 2:231963202-231963224 GTTTAAATGTTCCCTTTCCAAGG 0: 1
1: 0
2: 1
3: 24
4: 330
947674325_947674332 3 Left 947674325 2:231963189-231963211 CCCACCAACAGTAGTTTAAATGT 0: 1
1: 0
2: 3
3: 21
4: 205
Right 947674332 2:231963215-231963237 CTTTCCAAGGGAGCCTAATGAGG 0: 1
1: 0
2: 1
3: 9
4: 106
947674325_947674329 -9 Left 947674325 2:231963189-231963211 CCCACCAACAGTAGTTTAAATGT 0: 1
1: 0
2: 3
3: 21
4: 205
Right 947674329 2:231963203-231963225 TTTAAATGTTCCCTTTCCAAGGG 0: 1
1: 0
2: 4
3: 32
4: 604

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947674325 Original CRISPR ACATTTAAACTACTGTTGGT GGG (reversed) Intronic
901561212 1:10072333-10072355 ATATTTAAACTACTGCTTGGAGG - Intronic
901694981 1:11000630-11000652 ACATTTACACAACTTTTGGAGGG + Intergenic
903568153 1:24284522-24284544 ATATTTAAACTACGGCTGGAAGG - Intergenic
903629024 1:24752299-24752321 ATATTTGAACCACTGTTTGTGGG - Intronic
905029790 1:34874305-34874327 ATATTTAAATCACTGTTGTTTGG + Intronic
906576022 1:46890851-46890873 ACATGTAATCTGCTGTTGTTAGG - Intergenic
906595952 1:47077046-47077068 ACATGTAATCTGCTGTTGTTAGG + Intronic
906856249 1:49308263-49308285 ACATTTAAACTACTCTGTTTGGG - Intronic
908356991 1:63331456-63331478 ACATTAAAACTACTATTTGTTGG + Intergenic
909095807 1:71287591-71287613 ACATGTAAACTACTCTTTTTAGG + Intergenic
909833785 1:80228080-80228102 ACATTTAATCTAGTGGTGGGAGG + Intergenic
911880648 1:103234832-103234854 ACAATTAAATAACTTTTGGTTGG + Intergenic
911927016 1:103845931-103845953 TCATTTAAGCTACTGTTGTTTGG - Intergenic
916435586 1:164775003-164775025 ACATATAAACAACTCTTGCTAGG - Intronic
918206908 1:182317581-182317603 ATGTTGAATCTACTGTTGGTTGG - Intergenic
918217912 1:182409062-182409084 CCATTTAAAACACTGTTGGCAGG - Intergenic
920331259 1:205210482-205210504 CCTTTTAAACTGCTGTTGGTGGG - Intronic
920572577 1:207028946-207028968 ACATTTTACCTAGTGTTGGGAGG - Intronic
1064550634 10:16497257-16497279 CCATTTAGACAAATGTTGGTAGG - Intronic
1065236362 10:23656953-23656975 ACATAGAAACTACTTTTTGTTGG + Intergenic
1065878785 10:30021486-30021508 ACATTTAAAATAATGATGGTTGG - Intronic
1067922089 10:50469659-50469681 ACATTCAGAATACTGGTGGTGGG + Intronic
1069376753 10:67800647-67800669 ACATTTAAATTTTTCTTGGTGGG + Intronic
1075815281 10:125260259-125260281 ACATTCAAACCACGGTAGGTTGG + Intergenic
1076396829 10:130144918-130144940 TCATGTAAATCACTGTTGGTGGG - Intronic
1078178960 11:8994022-8994044 CCATTTAAACTACGGTAAGTTGG - Intronic
1078506388 11:11951468-11951490 ACATTTAAAGTATTGGTGTTTGG + Intronic
1086804702 11:91225959-91225981 ACTTTTAAACTGTTGTTGGGTGG + Intergenic
1086829841 11:91547825-91547847 AGCTTTAAACTACAGTTGCTTGG + Intergenic
1088227535 11:107637861-107637883 TCATCTAAAATACTGTTGGAGGG + Intronic
1088805074 11:113344878-113344900 ACATTTCAAATACTGTTGCATGG + Intronic
1091634190 12:2185088-2185110 ACATTTGAACTCCTGCTGCTTGG - Intronic
1092840026 12:12531612-12531634 TCCTTTAAACTACTTTTGGGAGG + Intronic
1092961817 12:13603086-13603108 AGCTTTAAGCTACTGTTGGATGG - Intronic
1093103741 12:15060216-15060238 ACTTTTAATACACTGTTGGTAGG - Intergenic
1093219871 12:16407444-16407466 ACACTTAATATACTGCTGGTGGG + Intronic
1094062541 12:26329971-26329993 ACATTTAAATAAATGTTGGTTGG + Intergenic
1094150984 12:27282801-27282823 CCATTTAAACATCTGTTAGTGGG + Intronic
1094769906 12:33643844-33643866 ACATTTATAATAATGTTGATAGG - Intergenic
1094770874 12:33657721-33657743 TAATTTAAACTAATTTTGGTTGG - Intergenic
1095823216 12:46503509-46503531 ACATTTAAAGTAATATTGATAGG + Intergenic
1096665862 12:53164336-53164358 AAATCTAATCCACTGTTGGTGGG - Intronic
1096820181 12:54227706-54227728 ACATTTCAGCTATTCTTGGTAGG - Intergenic
1097482405 12:60146140-60146162 ATGTTTAAACTACAGTTAGTTGG - Intergenic
1098537438 12:71609337-71609359 TCATTCAAACTACGGTTGGGAGG + Intergenic
1098655181 12:73019221-73019243 CCATTTAAACTACTGTTTTAAGG - Intergenic
1100096932 12:91051843-91051865 ACATTTAGATTGCTGTAGGTAGG + Intronic
1100530627 12:95458126-95458148 ACTTTTAGACTCCTGTTGATTGG + Intergenic
1100670371 12:96805620-96805642 ACTTTTATAACACTGTTGGTGGG + Intronic
1101237882 12:102807700-102807722 ATAGTTAAACTGCAGTTGGTTGG + Intergenic
1102938344 12:116916088-116916110 ACATCTTATCTACTGTTGATGGG + Intronic
1105950507 13:25225544-25225566 TCATTTAAAATACGGTAGGTAGG - Intergenic
1107214831 13:37904157-37904179 ACATTTAAACTAATCCAGGTAGG - Intergenic
1109722988 13:66300253-66300275 AAATTTTTACTACTGTTGTTGGG + Intergenic
1111511929 13:89277902-89277924 GAATTTGAACTACTGTTAGTGGG + Intergenic
1111643578 13:91002005-91002027 ACAATTAAACTAGTTTTGCTAGG + Intergenic
1115111799 14:29832247-29832269 ACTCTTAAACTTCTGTTGGTGGG + Intronic
1115219168 14:31042125-31042147 ACATTTTAAGTAATGTTGGCCGG - Intronic
1115462535 14:33677311-33677333 ACATTTAAACCACTGCTGCTTGG - Intronic
1115799801 14:36980109-36980131 ACAGTTAAAAAACTGTTGATGGG + Intronic
1118675387 14:68179168-68179190 ACAGTTAAATTACTGTTTATTGG + Intronic
1118927312 14:70204522-70204544 TGATTTAAGCTGCTGTTGGTTGG - Intergenic
1120011733 14:79423213-79423235 ACATATCAACTACTCTGGGTTGG + Intronic
1121723596 14:96129899-96129921 AAGTTTAATCTACTTTTGGTTGG + Intergenic
1122806141 14:104259368-104259390 ACATTTAATGTATTATTGGTAGG - Intergenic
1123915517 15:25021643-25021665 ACCTTTAATCTTGTGTTGGTAGG - Intergenic
1124176551 15:27430630-27430652 TCATTTAAACAAATGTTGCTGGG - Intronic
1126958542 15:53963063-53963085 AAATTTAAACTACAGAAGGTAGG + Intergenic
1129648928 15:77465688-77465710 ACATTAAAGCTACTGTGGGCTGG - Intronic
1135041387 16:19119958-19119980 ACATTTAAATTAATTTTGGGGGG + Exonic
1139104564 16:63812391-63812413 ACATTAAAACTACAGGTTGTTGG - Intergenic
1139524907 16:67509277-67509299 ACACTTGAACTCCTCTTGGTGGG + Intergenic
1139878066 16:70162518-70162540 ACATTTTAACTACTCTTGCACGG + Exonic
1141241246 16:82266984-82267006 ACATTTAAGCAACTGCTGGGGGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1146448944 17:32956508-32956530 ATGTTTAAGCCACTGTTGGTTGG + Intergenic
1148517974 17:48239809-48239831 TCATTCTAATTACTGTTGGTGGG - Intronic
1149189759 17:54046454-54046476 ACATTTAAACTATTATAGGAAGG + Intergenic
1157093969 18:44669632-44669654 TCATTTAAAATTCTGTTTGTGGG - Intergenic
1157462899 18:47917380-47917402 ACTTGTAAAATACAGTTGGTTGG + Intronic
1158367278 18:56751748-56751770 TCACTTTAACTAGTGTTGGTAGG + Intronic
1159170757 18:64763359-64763381 ACACTTAAAATACTGCTGGTGGG + Intergenic
1159400121 18:67920392-67920414 ACGTTTATACCACTGTTGGAGGG - Intergenic
1162037415 19:7949075-7949097 TAATTTAAACTAATTTTGGTTGG - Intergenic
1164766062 19:30771173-30771195 ACATTTCAACTAATGTTGGTGGG - Intergenic
1166655416 19:44607697-44607719 CAATTTAAACTAATTTTGGTTGG - Intergenic
1167400954 19:49268651-49268673 ACATTTAAAGAACTGTAGCTGGG - Intergenic
925310244 2:2876644-2876666 ACTTTTGAACTCCTTTTGGTAGG - Intergenic
925617575 2:5758324-5758346 ACATTTAAATTACTTATGCTTGG - Intergenic
926178624 2:10619451-10619473 ACACTTAAACTACAGTGGTTTGG - Intronic
926681888 2:15670480-15670502 ACACTTAAAACACTTTTGGTGGG - Intergenic
927428705 2:23008566-23008588 ACATCCAAAGTACTGTTGGATGG + Intergenic
929105146 2:38357917-38357939 ACAATTAAACCACTGTTTGGGGG + Intronic
930051335 2:47218414-47218436 CCATTTAAACGACTGTGTGTTGG + Intergenic
930193845 2:48488738-48488760 ATATTTGAACTAATGTTAGTTGG + Intronic
931495593 2:62803395-62803417 GCATTTCAATCACTGTTGGTGGG - Intronic
931673844 2:64673469-64673491 AGATTTAAGCCACTGTTTGTTGG + Intronic
933672858 2:85025962-85025984 AAATTTAAAATTCTGTAGGTGGG - Intronic
933732366 2:85467014-85467036 ACATTTAAACTATAGCAGGTGGG + Intergenic
933770282 2:85739615-85739637 TCATTTAAAATACTTTTGGCTGG + Intergenic
937397686 2:121552721-121552743 ACACTTAACACACTGTTGGTGGG + Intronic
938552182 2:132392530-132392552 ACATTTAAAATACTGCTGAAAGG + Intergenic
939977733 2:148738492-148738514 AAATTTAAAGTACTTTTGATTGG + Intronic
940783204 2:157955090-157955112 TTGTCTAAACTACTGTTGGTTGG - Intronic
943645352 2:190404062-190404084 AAATTTAAACCACTGTATGTGGG + Intergenic
943805270 2:192117362-192117384 AAATTTAAAATACTGGTAGTAGG + Intronic
945102662 2:206275487-206275509 ACATTTACACAACTGTTGCACGG - Intronic
946103284 2:217346149-217346171 ACATTTTATACACTGTTGGTGGG - Intronic
946463304 2:219889361-219889383 ACATTTAAACTGCTGTGTGGGGG + Intergenic
946971173 2:225093468-225093490 ACAATTACACTGATGTTGGTAGG - Intergenic
947674325 2:231963189-231963211 ACATTTAAACTACTGTTGGTGGG - Intronic
1169700416 20:8440154-8440176 AGATTTAAACTAGTGGTGTTTGG + Intronic
1173882959 20:46432752-46432774 ATATTTAAACCACTGTAAGTTGG - Intronic
1174860883 20:54089900-54089922 CAGTTTAAACTACTGTTTGTTGG - Intergenic
1179376727 21:40855866-40855888 ACAAGGAAACTAATGTTGGTGGG + Intergenic
1181139680 22:20795372-20795394 TAATTTAAACTAATTTTGGTTGG - Intronic
1181889435 22:26048902-26048924 ACACTTCTACCACTGTTGGTGGG - Intergenic
949108517 3:229661-229683 ACATTTTATCGACTCTTGGTGGG + Intronic
950311717 3:11964572-11964594 AAATATAAACTACTGTTACTTGG - Intergenic
950351702 3:12360818-12360840 ATATTTATCCTACTGTTGATGGG + Intronic
950820719 3:15755275-15755297 ACATGTTAACTAATGTTGGTGGG - Intronic
952871056 3:37901820-37901842 ATATTTAAGCTACTTGTGGTTGG - Intronic
953151028 3:40324854-40324876 ACACTTATAATACTGTTGGTGGG + Intergenic
953427872 3:42810625-42810647 CAATTTAAACTAATTTTGGTTGG - Intronic
955278307 3:57569243-57569265 ACATTTAAACCACTTCTGTTTGG + Intergenic
956255748 3:67281783-67281805 ACACTTTTACCACTGTTGGTGGG + Intergenic
956608526 3:71097994-71098016 CCTTTTAAACATCTGTTGGTAGG + Intronic
958076550 3:88688822-88688844 ACACTTAATACACTGTTGGTGGG - Intergenic
958510237 3:95038035-95038057 AGATCTAAACTGTTGTTGGTGGG - Intergenic
958592232 3:96172636-96172658 ACATTTAAACTAGTTGTGGAGGG + Intergenic
958780334 3:98533128-98533150 ACATTTCAAGCTCTGTTGGTGGG + Exonic
958933928 3:100237698-100237720 ACATTTAAACAACTGTGTGATGG + Intergenic
959306855 3:104678235-104678257 ACTTTTAGACTCCTGCTGGTTGG - Intergenic
959615390 3:108341719-108341741 ACATTTAAACTACTGTGAGTTGG - Intronic
959760348 3:109955735-109955757 ACCTCTTAACTACTATTGGTGGG - Intergenic
960159218 3:114331679-114331701 ACATAGAAATTACTGATGGTTGG + Intergenic
960307953 3:116085544-116085566 ACATTGAAACTGCTGGTGGTTGG + Intronic
961189023 3:124941814-124941836 ACATTTAAACCTCTGTTGTTGGG - Intronic
962123634 3:132590617-132590639 ACACTTAATACACTGTTGGTGGG - Intronic
964185353 3:153936016-153936038 AAGTTTAAACTACTTTTAGTAGG - Intergenic
965415523 3:168387874-168387896 GCATTTTAATTACTGTTGGTGGG + Intergenic
968492314 4:896587-896609 ACATAAAAAATACTGTTTGTGGG - Intronic
973247170 4:48021536-48021558 ACATTAGAAGTACTGTTTGTGGG + Intronic
975099734 4:70499066-70499088 ACTTTTAAAGTTCTGTTTGTTGG - Intergenic
975950043 4:79759400-79759422 AAATTTAAGGTACTGTTGTTTGG + Intergenic
976877209 4:89867705-89867727 ACATTCAACCTACTGTGGGTTGG + Intergenic
977570879 4:98628238-98628260 ACATCTAGACTAGTGTTTGTGGG + Intronic
979043135 4:115825408-115825430 ACATTTCTCCCACTGTTGGTGGG - Intergenic
980245432 4:130233626-130233648 CCATTGAAAATACTTTTGGTTGG - Intergenic
980628160 4:135402833-135402855 ATATTTAAAATACTTTTAGTTGG + Intergenic
981003002 4:139846296-139846318 ATATTTAAACTATTATTAGTAGG - Intronic
981319819 4:143378937-143378959 ACATCAAAAATACTGTTGGGAGG - Intronic
982509128 4:156258834-156258856 AAATTTAAAATACAGTTGTTGGG + Intergenic
982819015 4:159923406-159923428 AAATTTAAACATCTCTTGGTAGG + Intergenic
984209818 4:176832805-176832827 ATTTTCAAACTACAGTTGGTTGG - Intergenic
986533664 5:8764118-8764140 CCCTTAAAACTAGTGTTGGTGGG - Intergenic
988113299 5:26851262-26851284 TCATTTAAAATACTCTTGGCCGG - Intergenic
990223361 5:53621108-53621130 ATTTTGAAACTACTGTTGGTTGG + Intronic
990317269 5:54595057-54595079 TCATTTAATCCACTGTTGATGGG + Intergenic
990365133 5:55062786-55062808 ACATTTAAAATACTCTAGGCTGG + Intergenic
993524132 5:88943521-88943543 ACATTTGTATTACTGCTGGTAGG + Intergenic
993831437 5:92764331-92764353 ACATTTAAGTTGCTTTTGGTTGG + Intergenic
994057192 5:95430809-95430831 ACATTTTACATATTGTTGGTGGG - Intronic
994308820 5:98241990-98242012 ATATTTAGACTACTGTTTATGGG + Intergenic
994957482 5:106552086-106552108 ACACTTAATTCACTGTTGGTAGG + Intergenic
995540937 5:113185501-113185523 ACTTCTAATCTCCTGTTGGTTGG - Intronic
995616924 5:113974941-113974963 TCATTTATTCTACTGTAGGTAGG + Intergenic
995741791 5:115363654-115363676 ACATTTAAAGCAGTGCTGGTGGG - Intergenic
996757672 5:126951731-126951753 ACATCTAATCTACTCTTGGCTGG - Intronic
997711416 5:136007975-136007997 ACATTTAAACTCTTGTGGGTAGG - Intergenic
1000623893 5:163516838-163516860 ATATGTAAACTACTTTTGTTTGG - Intronic
1000706190 5:164515137-164515159 ACAATAAAACTACAGATGGTTGG - Intergenic
1003616983 6:7663863-7663885 ACACTTAATACACTGTTGGTGGG + Intergenic
1004564974 6:16787807-16787829 ACATTTAAACTATTCTTGCCAGG - Intergenic
1007456003 6:41977661-41977683 CCATTTAAAGTACAGTTGGCTGG - Intronic
1010880338 6:81160413-81160435 ACATTAAAACTAATGGTTGTTGG + Intergenic
1011720133 6:90147515-90147537 ACAATGAAACTACTGTTGTAGGG - Intronic
1012168997 6:95994920-95994942 ACTTTTGCACTACTGATGGTGGG + Intergenic
1014149431 6:118036724-118036746 ATTTTTAAACTTCTTTTGGTAGG + Intronic
1014168862 6:118255699-118255721 ACATTTAAATTCCTATTGGTAGG + Intronic
1020218936 7:6219132-6219154 ACATTAAATGTACTGCTGGTAGG + Intronic
1020542707 7:9480087-9480109 ACCTTTTAACTCCTGTTGGTGGG - Intergenic
1022431474 7:30326746-30326768 ACACTTAACACACTGTTGGTGGG - Intronic
1022828625 7:34042527-34042549 ACATTTTAGGTACTGTTTGTTGG - Intronic
1026158074 7:67844774-67844796 ACATTTTAAAGACTATTGGTTGG - Intergenic
1027593992 7:80150069-80150091 AGCTTTAATGTACTGTTGGTTGG + Intronic
1027861029 7:83581543-83581565 ATTTTTAAACTACTATTTGTTGG + Intronic
1027866694 7:83657693-83657715 ATATTTAAATCACTGTTGTTTGG - Intergenic
1028114270 7:86980100-86980122 ACACTTATACTATTGTCGGTTGG + Intronic
1031734896 7:125346397-125346419 AAATTTGAACTACTGTGAGTTGG - Intergenic
1032918630 7:136520641-136520663 AAATATATACTACTGTTGGCCGG + Intergenic
1034674327 7:152881769-152881791 GTATTGAAACTACTGTTGCTGGG - Intergenic
1037065559 8:14573061-14573083 AGATTTGTACTACTGGTGGTAGG + Intronic
1039010161 8:33085184-33085206 AAAATCAAAATACTGTTGGTGGG - Intergenic
1043203429 8:77404383-77404405 GCATTTCTACTACTGTTGTTTGG - Intergenic
1043297113 8:78679834-78679856 ACATTTAAAGTAAGGATGGTGGG + Intronic
1043923180 8:86007015-86007037 GCATCTAAACTTCTGTTAGTTGG + Intronic
1044077727 8:87844213-87844235 ACATTTACAGCACTGGTGGTGGG - Intergenic
1044876847 8:96677283-96677305 ACATTTTTAGAACTGTTGGTGGG - Intronic
1046824488 8:118672268-118672290 ACATTCAAAATACTGTTGACTGG - Intergenic
1047477718 8:125250262-125250284 ACATATAAAATAGTGTTGCTGGG - Intronic
1048212416 8:132466418-132466440 ACATTTAGGCTACTTTTGGCAGG - Intronic
1050376362 9:4977658-4977680 ACGTTTAAAATTCTGTGGGTTGG + Intergenic
1050810626 9:9742065-9742087 ATATTAAAAACACTGTTGGTGGG - Intronic
1051151982 9:14091008-14091030 ACATTTAAATTAAATTTGGTAGG - Intronic
1055074825 9:72203286-72203308 ATATTTAAATTACTGTTAGAAGG + Intronic
1055123932 9:72696818-72696840 ATATTTAAACAACAGTTGTTAGG - Intronic
1057351584 9:94303174-94303196 ACCTTTAAAACACTGTTGGTAGG - Intergenic
1058016272 9:100035928-100035950 GCACTTAAACAACTGTTGATGGG + Intronic
1058930732 9:109716452-109716474 ACATTTATACTGCTGTTTATTGG - Intronic
1059633380 9:116149155-116149177 ACAACTAAACTACTGTTGGGGGG + Intergenic
1059790202 9:117634418-117634440 ACATTTAAAACACTATTGGCTGG - Intergenic
1203452071 Un_GL000219v1:127020-127042 ACATTTAAAGTCTTGTTGATAGG - Intergenic
1186811698 X:13196298-13196320 ACATTTGATCTACTGTGTGTTGG - Intergenic
1188288142 X:28354880-28354902 CCATTTAAACTGCTCTTGGCCGG + Intergenic
1188303527 X:28534047-28534069 TCATTTAAAAAACTTTTGGTAGG - Intergenic
1188429794 X:30093478-30093500 GCATTCAAACTACTGTCGTTAGG - Intergenic
1188800088 X:34518690-34518712 ACATTTTAATTACTGGTGATTGG - Intergenic
1189386065 X:40537960-40537982 AGATTTAAGCCACTGTTAGTTGG + Intergenic
1190821275 X:53975251-53975273 ACATTCATACTACTGTTGGTGGG + Intronic
1194061645 X:89209928-89209950 ACATTTATATTAGTGTTTGTTGG + Intergenic
1194280932 X:91953326-91953348 ACATTTAAAAAAATGTTTGTGGG - Intronic
1194377969 X:93159453-93159475 ATGCTTATACTACTGTTGGTGGG + Intergenic
1198940431 X:141949570-141949592 ACTTTTATACTATTGTTGGTTGG + Intergenic
1198947925 X:142035917-142035939 ATATTAAAACTACTTTAGGTTGG - Intergenic
1200598524 Y:5177986-5178008 ACATTTAAAAAAATGTTTGTGGG - Intronic
1200715567 Y:6539232-6539254 ACATTTATATTAGTGTTTGTTGG + Intergenic
1201311273 Y:12600065-12600087 ACATTTAGACTCCTGCTGATTGG + Intergenic
1201785852 Y:17777969-17777991 GCATTTAAAATACTGTTTCTTGG + Intergenic
1201815701 Y:18128019-18128041 GCATTTAAAATACTGTTTCTTGG - Intergenic