ID: 947678304

View in Genome Browser
Species Human (GRCh38)
Location 2:232005642-232005664
Sequence CAGGGTAAACAAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 465}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947678304_947678308 -10 Left 947678304 2:232005642-232005664 CCTTCCTCCCTTTGTTTACCCTG 0: 1
1: 0
2: 5
3: 43
4: 465
Right 947678308 2:232005655-232005677 GTTTACCCTGCAGAATCTATAGG 0: 1
1: 0
2: 1
3: 7
4: 105
947678304_947678311 15 Left 947678304 2:232005642-232005664 CCTTCCTCCCTTTGTTTACCCTG 0: 1
1: 0
2: 5
3: 43
4: 465
Right 947678311 2:232005680-232005702 GTTGTTTCTGATTTTTTTCCAGG 0: 1
1: 0
2: 5
3: 69
4: 802
947678304_947678312 16 Left 947678304 2:232005642-232005664 CCTTCCTCCCTTTGTTTACCCTG 0: 1
1: 0
2: 5
3: 43
4: 465
Right 947678312 2:232005681-232005703 TTGTTTCTGATTTTTTTCCAGGG 0: 1
1: 0
2: 6
3: 105
4: 1245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947678304 Original CRISPR CAGGGTAAACAAAGGGAGGA AGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900324453 1:2101397-2101419 CAAGGGAAAGAAAGGAAGGAGGG - Intronic
901403863 1:9032949-9032971 CAGGAATAGCAAAGGGAGGAAGG + Intergenic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
904751465 1:32743242-32743264 GAGGGTAAACACAGGCAGAATGG - Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905342769 1:37290644-37290666 GAGGGTACAAAAATGGAGGAAGG - Intergenic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905592072 1:39172914-39172936 CAAGGACAAAAAAGGGAGGAGGG - Intronic
906701157 1:47859209-47859231 CAGGAAAAAGAAAGGAAGGATGG - Intronic
907229215 1:52979907-52979929 AAAGGGAAAGAAAGGGAGGAAGG - Intronic
907265959 1:53261434-53261456 GAGGGAAAGCAAAGGGATGATGG - Intronic
908267593 1:62394637-62394659 TAGTGTAGACAATGGGAGGAAGG + Intergenic
910741041 1:90516846-90516868 CATGATAGAGAAAGGGAGGACGG + Intergenic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
913423738 1:118703564-118703586 CAGCACAAACAAAGGAAGGATGG + Intergenic
915049490 1:153052895-153052917 CAGGGAAGACAAAGAGAGAAAGG + Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915488892 1:156240812-156240834 CAGGGCAGCCAAAGGCAGGATGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916856908 1:168759538-168759560 GAGGGTAAACAAAGTCAGAAAGG + Intergenic
918677405 1:187304689-187304711 GAGGGTAAAGGATGGGAGGAGGG - Intergenic
918807746 1:189071323-189071345 CAGGGGAAGCAAAGGGAGTAGGG + Intergenic
919926118 1:202192740-202192762 TAGGGCAAAAAAAGGAAGGAGGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920035170 1:203060726-203060748 TGGGGGAAACAAAGGGAAGAGGG + Intronic
920116319 1:203624380-203624402 AAGGGGAAAGAAAGGGAGAAAGG + Intergenic
920540541 1:206774583-206774605 GATGGGAAACAAAGGAAGGAGGG - Intergenic
920816689 1:209341085-209341107 CAGGGGAAAGTAAGGGAGAAAGG - Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
923198776 1:231692213-231692235 CAGAGTAAAGAAAGGAAGGGAGG - Intronic
923544766 1:234916119-234916141 CAGGGCAAACAAAGTTAGGAAGG - Intergenic
923751820 1:236753822-236753844 AAGGAGAAACGAAGGGAGGAGGG - Intronic
1063143133 10:3273782-3273804 CAGGGGAAACGAGGAGAGGATGG + Intergenic
1063674166 10:8125130-8125152 CAACAGAAACAAAGGGAGGAGGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064317931 10:14275510-14275532 CAGTGCAAAGAAAGGGAGAAAGG + Intronic
1064318820 10:14282497-14282519 CAGCTTAAATAAAGGTAGGAGGG + Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1065055625 10:21839001-21839023 CTGGGTAAATAAAGAAAGGAAGG + Intronic
1066275617 10:33865639-33865661 CAGGGAAAAGAAAGGAAGGAAGG - Intergenic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1068017273 10:51532863-51532885 GAGGATAAAGAAAGGGAGAAGGG - Intronic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068873691 10:61973606-61973628 CAGTGTAAAAAATGGGAGGGGGG + Intronic
1069403785 10:68076688-68076710 CAGGGAAAACAAGGTGAAGAGGG - Intergenic
1070055038 10:72926133-72926155 CAGCTTAACCAAAGGGAGAATGG + Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070252648 10:74786580-74786602 CATGGTAAACGAAGAAAGGATGG + Intergenic
1071848041 10:89540021-89540043 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074813777 10:117129854-117129876 CAGGAAAAAAAAAGGAAGGAGGG + Intronic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075282456 10:121151655-121151677 CAGAGTAAACAAGGGGAGAATGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075940277 10:126385727-126385749 TAGGGTGAGCAAAGGGAGAATGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077321849 11:1946380-1946402 CAGAGGAAACCAGGGGAGGAGGG + Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079496034 11:21045088-21045110 CAGGGCAAGTAAAGGCAGGAGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1080925945 11:36755926-36755948 CAGGGTGAATAAGGTGAGGATGG + Intergenic
1081612276 11:44569690-44569712 CAAGGTAAAAATAGGGAGGTAGG - Intronic
1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082906735 11:58315879-58315901 CAGATTAAACAAAGGCAGAAAGG + Intergenic
1083273485 11:61583961-61583983 CAGGGTAAACACAGCAATGATGG - Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1084164003 11:67366751-67366773 CAGGGAAAGAAAAGGGAGGAGGG - Intronic
1084912734 11:72404265-72404287 CAGTGCCAAGAAAGGGAGGAGGG + Intronic
1085097982 11:73775996-73776018 CAAGGTCAAGAAGGGGAGGAAGG + Intergenic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1086855926 11:91865774-91865796 CAGGGAAAGTGAAGGGAGGAGGG + Intergenic
1087761762 11:102110469-102110491 CAGGGAAAAGAAAGGGAGGAAGG + Exonic
1088056885 11:105593631-105593653 AAGGGTAAAAAAGGGGAGGTTGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1202804866 11_KI270721v1_random:1693-1715 CAGAGGAAACCAGGGGAGGAGGG + Intergenic
1092431783 12:8415653-8415675 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092434734 12:8438273-8438295 CAGGGACAGCAAAGTGAGGACGG + Intergenic
1092457199 12:8654537-8654559 CAGAGTAAGAAAAGGGAGAATGG + Intronic
1093224015 12:16459444-16459466 CAGGCTAACCAAAGGGAGAAAGG - Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1093828438 12:23724902-23724924 TGGGGTAAACAAAGGAAGTAGGG + Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1099141155 12:78977142-78977164 AAGGGCAAAGAAAGTGAGGAAGG + Intronic
1099567230 12:84267755-84267777 CAAGGGAAACCAAAGGAGGAGGG + Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1100872984 12:98931753-98931775 GGGGGTAAACACAGGGATGAAGG - Intronic
1103131954 12:118477026-118477048 GAGGAGAAAGAAAGGGAGGAAGG - Intergenic
1103154406 12:118671813-118671835 CTGGGTAAATAAAGAAAGGAAGG - Intergenic
1103437491 12:120937976-120937998 CATGGAAATGAAAGGGAGGAAGG + Intergenic
1103612646 12:122133535-122133557 CATGGTGAAGACAGGGAGGAAGG - Exonic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104197522 12:126555172-126555194 CAGAGCAAACAAAGATAGGAAGG + Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1104962221 12:132493702-132493724 CAGGGTACACAAAGGGGGCGGGG - Intronic
1105996678 13:25679082-25679104 CCAGGTAAGCAATGGGAGGAAGG + Intronic
1106469411 13:30040973-30040995 CAGGGAAAACTAAGTGAGGGAGG - Intergenic
1107999993 13:45897180-45897202 GAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1108111498 13:47078621-47078643 GAGGGTTAAGAATGGGAGGAGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1111820090 13:93203134-93203156 CAGGGGAAAGAATGGGAGTAGGG - Intergenic
1111856040 13:93639125-93639147 CAGGGAAAATAAAGCAAGGAGGG + Intronic
1113262914 13:108585567-108585589 GAAGGAAAACAAAGGGAGAAGGG + Intergenic
1115635539 14:35287243-35287265 CTGGGTAAAGAAAGGGACGTAGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117830324 14:59743715-59743737 CAGGGGAAACAAAGAGGTGAAGG - Intronic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1118615150 14:67569928-67569950 CAGGGGAAACAAGGGCAGGAGGG - Exonic
1119140316 14:72261377-72261399 CAGGTCATACAAAAGGAGGAGGG + Intronic
1119892738 14:78195064-78195086 CAGGGAAAAAAAAGGGTGGGGGG - Intergenic
1121317925 14:92973326-92973348 CACTGGAAACAAAAGGAGGAGGG + Intronic
1121497343 14:94402983-94403005 CAGGGGAAAGAAAGGAAGGAAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122242174 14:100376241-100376263 CAGGGTAAGCGAGGGGAGTAAGG - Exonic
1122718828 14:103710924-103710946 CAGGGTAGGCAAAGGAAGGAAGG + Intronic
1125832609 15:42727587-42727609 CAGGGAAGCCAAAGGGAGTAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127805147 15:62512370-62512392 AAGGTTAAACAAAGAAAGGAAGG - Intronic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131488749 15:92843887-92843909 GAGGGAAAAAAAAGGTAGGAAGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1134295595 16:12942693-12942715 CTGGGTAAACAAAGTGAAAAGGG - Intronic
1135405197 16:22192562-22192584 CAGGGAGAAGAAAGAGAGGAAGG - Intergenic
1136622100 16:31436180-31436202 CAGGATAAAGGAAGGGAGGTCGG + Exonic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137622418 16:49884638-49884660 GAGGATAAAGAAAGGAAGGAAGG + Intergenic
1138331879 16:56221874-56221896 GAGGGGAAACCAAGGCAGGAGGG + Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1139072553 16:63401037-63401059 CAGGGTTAACTAAGAGTGGAAGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1142693576 17:1621250-1621272 CCGGGGAGACAAAGGGAGGGGGG + Intronic
1142753583 17:2002643-2002665 CAGAGAAAAGAAAGGAAGGAAGG - Intronic
1143638792 17:8183283-8183305 CATGGTAAACAAATTGATGATGG - Intergenic
1143729345 17:8872052-8872074 GAGGGTAAAGAAATTGAGGAGGG - Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1146619305 17:34385195-34385217 AAGGGAAAAAAAAGGAAGGAAGG - Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1151518100 17:74609945-74609967 TAGGGGAAAAAAAGGGAGTAAGG + Exonic
1152105187 17:78324594-78324616 AAGGGGAAAAAAAGGGAGGGAGG - Intergenic
1152146138 17:78570029-78570051 GAGGGAAAAGAAAGGGAAGACGG - Intronic
1153068733 18:1079573-1079595 GAGGGTAGAGAATGGGAGGAGGG + Intergenic
1154498610 18:14981054-14981076 CAGGAGAAACCAAGGGAGGCAGG - Intergenic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155479861 18:26273693-26273715 GAGGGTAAAAAATGGGAAGAAGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156805374 18:41172798-41172820 TAGGGAAAAGAATGGGAGGAGGG - Intergenic
1157772150 18:50358633-50358655 GAGGGAAAAGAAAGGGAAGATGG - Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1158762249 18:60403630-60403652 CAGAGTAAAACAAGAGAGGAGGG - Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1165209595 19:34223385-34223407 CAGGCTTACAAAAGGGAGGATGG - Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1166699176 19:44872272-44872294 CAGTGTAGACAATGGCAGGAAGG - Intronic
1166966015 19:46529621-46529643 AAAGGGAAAGAAAGGGAGGAAGG + Intronic
1167046012 19:47049096-47049118 CGGGGAAAAAAAAGGAAGGAGGG - Intergenic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1168193476 19:54756592-54756614 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168195539 19:54771330-54771352 CAGGGTAGACATGGGGTGGAGGG - Intronic
1168428303 19:56257310-56257332 CTGGGAGAACAAAGGGAGGCAGG + Intronic
1168710114 19:58494725-58494747 CAACAGAAACAAAGGGAGGAGGG - Intronic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
926296187 2:11570628-11570650 AAGGGTAAAACTAGGGAGGAAGG - Intronic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
928692638 2:33816737-33816759 GAGGGAAAAAAAAGGAAGGAAGG - Intergenic
928756414 2:34531090-34531112 CAGCCTAAAGAAAGGGAGCATGG + Intergenic
930270002 2:49245053-49245075 CTGGGTAAATAACGAGAGGAAGG + Intergenic
930635126 2:53796277-53796299 GAAGGTAAAGAATGGGAGGAGGG - Intronic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931662595 2:64581129-64581151 GAAGGTAAGCCAAGGGAGGAGGG - Intronic
931913150 2:66924249-66924271 CAGAATAAAACAAGGGAGGAGGG - Intergenic
933980606 2:87547305-87547327 CAGGGTAAGCATAGGAAGCACGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
935580347 2:104750739-104750761 CAGGGTGAAGACAGGGAGGTGGG - Intergenic
935874791 2:107494749-107494771 CAGAGGAAAGAAAGAGAGGAAGG + Intergenic
936276681 2:111103972-111103994 GAGGGTAAAGGAAGGGAAGAGGG - Intronic
936313221 2:111403486-111403508 CAGGGTAAGCATAGGAAGCACGG - Intergenic
937501582 2:122484859-122484881 AACGGTACAGAAAGGGAGGAAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938743933 2:134259494-134259516 CAGGGTTAACAACGTGTGGATGG - Intronic
939633495 2:144552984-144553006 AAGGGAAAAGAAAGGAAGGAAGG + Intergenic
939754247 2:146090056-146090078 CAGGGTGAAGGAAGGGAGAAGGG - Intergenic
940638599 2:156326644-156326666 AAAGGAAAAGAAAGGGAGGAAGG - Intronic
940835774 2:158519869-158519891 AAGGGTATACAAAGATAGGATGG - Intronic
941318690 2:164027324-164027346 CAGGATGAAGAAAAGGAGGATGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943658458 2:190533700-190533722 CAGGGTAGCCAAAGCAAGGAAGG + Intronic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
946396549 2:219446245-219446267 CCTGGTAAAGAAAGGCAGGAAGG - Intronic
946817633 2:223595223-223595245 CAGAGTATACAATGGGTGGAAGG + Intergenic
946973696 2:225123450-225123472 GAAGGAAAAGAAAGGGAGGACGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948324666 2:237104334-237104356 TAGGATAAACAAAGGGACCAGGG + Intergenic
948384897 2:237575212-237575234 CAGGGTAAACACAGGAGGGGCGG - Intronic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1169079972 20:2792032-2792054 CAGTGTCAACAAAGGCAAGAGGG - Intergenic
1169945695 20:10985685-10985707 CAGGGAAAAGAAATAGAGGACGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172885272 20:38226827-38226849 CTCTGAAAACAAAGGGAGGAGGG + Intronic
1173705158 20:45104799-45104821 CAGGGTAAAGAAAGGGCAGGAGG - Intergenic
1174306027 20:49614931-49614953 TAGAGAAAACAAAGGGAGAACGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175767230 20:61599898-61599920 CTTGGAAAATAAAGGGAGGAAGG + Intronic
1176135198 20:63519482-63519504 AACGGTAAACCAAGGGAGAACGG - Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177306895 21:19330264-19330286 AAGGATAACCAAAGAGAGGAGGG - Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1178480669 21:32977143-32977165 GAGGGAAAAAGAAGGGAGGAGGG - Intergenic
1178753822 21:35328840-35328862 GAGGGTAAAATAAGGAAGGAGGG - Intronic
1179030028 21:37712471-37712493 GAGGGAAGAGAAAGGGAGGAGGG - Intronic
1179030043 21:37712516-37712538 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030089 21:37712656-37712678 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030102 21:37712701-37712723 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179414200 21:41185297-41185319 GGGGCTAAACAAATGGAGGAAGG + Intronic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1179782468 21:43710617-43710639 GAGAGAAAACAAAGGAAGGAAGG + Intergenic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181490667 22:23258993-23259015 CAGGCGGAACAAAGGGAGCACGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1182146162 22:27998110-27998132 CAGGGGTAACAAGGGGATGATGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184610342 22:45599273-45599295 CAGGGCAGTCAAAAGGAGGATGG - Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951658630 3:25037354-25037376 CAGGGCAAACATGGGGTGGAGGG + Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
954050929 3:47976466-47976488 CAGGGTAAGGAAAGGCTGGAGGG - Intronic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954627809 3:52032145-52032167 CAGGATAAAAGAAGAGAGGAAGG - Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
959667833 3:108941516-108941538 CAGGGGAATGAAATGGAGGAGGG - Intronic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960902515 3:122566334-122566356 CAGGGCAAGCAAGGGGAAGATGG + Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961144114 3:124579956-124579978 CATGGTCTCCAAAGGGAGGAAGG + Intronic
961875776 3:130022429-130022451 CAGGGACAGCAAAGCGAGGACGG + Intergenic
961910261 3:130307603-130307625 CAGGGAGAAGAATGGGAGGAGGG + Intergenic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
962353508 3:134673617-134673639 CAGGGTACACAAAAGGACAAAGG - Intronic
962597426 3:136960805-136960827 CAAGGTAGAAGAAGGGAGGAGGG + Intronic
962996967 3:140639339-140639361 CAAGGTAAACAAAGAGCAGAAGG - Intergenic
964741463 3:159970579-159970601 GAGGGTAAATAAAGGGTGGTAGG - Intergenic
965069094 3:163894219-163894241 CAAGGTACACAATGGGAGGAGGG + Intergenic
965420332 3:168449945-168449967 GTGGGGAAACAAAGGGAGAATGG - Intergenic
965716144 3:171605259-171605281 CAGTGAAAAGAAACGGAGGAGGG + Intronic
966210894 3:177452415-177452437 GAGGGGAAAGAAAGGGAGGGAGG - Intergenic
966374936 3:179286804-179286826 AAGAGGAAACAAAGGTAGGAGGG - Intergenic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967597950 3:191349970-191349992 CAGGAAAAAAAAAGGGAGGGGGG - Intronic
967828265 3:193896293-193896315 CGGGGAAGACACAGGGAGGAGGG + Intergenic
969481316 4:7448543-7448565 GAGGGTAGAGAAAGGGAGGGAGG - Intronic
969920060 4:10530026-10530048 AAGGTGAAAGAAAGGGAGGAAGG - Intronic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970331803 4:14994202-14994224 CAAGGTAAGGAAAGGAAGGAGGG - Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970581454 4:17477608-17477630 CCTGGTAGAGAAAGGGAGGATGG - Intronic
971596834 4:28540281-28540303 AAGGGGAAAGAAAGGTAGGAGGG - Intergenic
971745879 4:30579807-30579829 AAGTCTAAACAAAGGGAGAAAGG + Intergenic
972842451 4:42947307-42947329 CAGGGAAAACTTAGGGACGAGGG + Intronic
973178374 4:47236683-47236705 CAGGTAAAACAAAGGCAGAAAGG + Intronic
973707626 4:53595709-53595731 CAGGGAAATCTAAGGGGGGAAGG + Intronic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
974142278 4:57902452-57902474 GAGGGGAAAAAAAGGCAGGATGG + Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976821754 4:89214669-89214691 AAGCCTAAAGAAAGGGAGGAAGG - Intergenic
977199076 4:94094205-94094227 GAGGGTAAAGGATGGGAGGAGGG - Intergenic
977476217 4:97513209-97513231 CAAGGTAAAGAAGGGGAGAAGGG + Intronic
979052923 4:115956912-115956934 TTGGGTAAACAAAGAGAGTAGGG - Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
981886140 4:149675311-149675333 TAGGGAAGACAAAGGGAGAATGG + Intergenic
982434415 4:155367269-155367291 CAGAGAAAACACAGGGAAGAAGG + Intronic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983454408 4:167944736-167944758 CACGATAAACAAAGTGATGATGG + Intergenic
983568603 4:169180550-169180572 CAGAGTAAACAAGGGGAGTATGG + Intronic
983795156 4:171853347-171853369 AAGGGGAAAGAAGGGGAGGAAGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985588518 5:753045-753067 CAGGTTAAACACAGGCAGCAGGG - Intronic
985589925 5:759257-759279 CAGTGTTAACAAAGGGCGCAGGG - Intronic
985603185 5:845484-845506 CAGGTTAAACACAGGCAGCAGGG - Intronic
986721218 5:10563114-10563136 CGGGGGAAAAAAAGGAAGGAAGG + Intergenic
987756861 5:22107695-22107717 AAAGGTAAACAAAGGGGGCAGGG + Intronic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
989852412 5:46230707-46230729 CAGAGTAAAAAACTGGAGGACGG + Intergenic
990136177 5:52646032-52646054 CAGGAGAAAGAAAGGGAGAAGGG - Intergenic
993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG + Intergenic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
993594684 5:89838574-89838596 CAGGAGAAACAAAGTTAGGATGG + Intergenic
994049643 5:95348033-95348055 TAGGGTAAACATTGGGAGAATGG + Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
995575043 5:113520904-113520926 GAGGGTAAAGGATGGGAGGAGGG - Intronic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
999008399 5:148007036-148007058 CTTGCTAAACAAAGGGAGAAAGG - Intergenic
999501777 5:152154090-152154112 TAGGATCAACAAAGGAAGGAGGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001298956 5:170519722-170519744 CAAAGTCAAGAAAGGGAGGAAGG + Intronic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002571558 5:180142559-180142581 GATGGCAAACAAAGGGAGCATGG + Intronic
1002713310 5:181208466-181208488 CACGGTAGCCAAAAGGAGGAAGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003274394 6:4636978-4637000 CAGGGTAAATATAGTCAGGAAGG - Intergenic
1003619484 6:7685383-7685405 CAGTGTAAACCAAGGGTGGTTGG - Intergenic
1004748668 6:18538573-18538595 CAAGGCAAAGAAAGGGAGGGAGG - Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005024023 6:21445704-21445726 AAGGGGAAAGAAAGGAAGGAGGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1005704361 6:28436718-28436740 AAAGGGAAACAAATGGAGGATGG + Intronic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1007013269 6:38438162-38438184 CAGGAAAAAAAAAGGAAGGAAGG + Intronic
1007220584 6:40275769-40275791 CAGGGTAAAGAAAGGGAGTAGGG - Intergenic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1008917114 6:56800173-56800195 CCGAGTAGACAAAGGGAAGAAGG + Intronic
1009362624 6:62834378-62834400 GAGGGTAAAGAATAGGAGGAAGG - Intergenic
1009825967 6:68866317-68866339 CAGGAGAAAGAAAGGGAGCAAGG - Intronic
1009938357 6:70260003-70260025 CAAGGCAAAGACAGGGAGGATGG - Intronic
1011038971 6:83009960-83009982 GAGAGTAGACAAATGGAGGAGGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012840526 6:104323874-104323896 GAGGGTAAAGAACGGGAGGAGGG + Intergenic
1013854666 6:114557377-114557399 TAGGATAAATGAAGGGAGGAAGG - Intergenic
1015059936 6:128951017-128951039 CAGGATAGAGAAGGGGAGGAAGG + Intronic
1016784311 6:147993291-147993313 GGGAGTAAAGAAAGGGAGGAGGG + Intergenic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018294982 6:162336047-162336069 CAGGGTAAGCAAGGGCAGCAAGG + Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018735935 6:166687238-166687260 CAGGGTCAACGAAGCGAGGCAGG - Intronic
1019234395 6:170597537-170597559 GAAGGGAAGCAAAGGGAGGAAGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021432496 7:20576457-20576479 CAGGTTGAAAAAATGGAGGAAGG - Intergenic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1024663603 7:51522798-51522820 CAGAGAAAACAAAAAGAGGATGG - Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1025231751 7:57207245-57207267 GAGGGAAAAAAAAGGAAGGAAGG - Intergenic
1026098947 7:67368946-67368968 CAGGGTAGAAAAAGTGAGGGAGG - Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029249162 7:99223720-99223742 AAGGGGAAAAAAAGGAAGGAAGG + Intergenic
1029380903 7:100213927-100213949 GAGGGTAACCCAGGGGAGGATGG + Intronic
1030486080 7:110169624-110169646 CAGAGTAAATTAAGGGAAGAGGG - Intergenic
1030847252 7:114435366-114435388 AAGGGTACACAAAGACAGGAAGG + Intronic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1034607359 7:152329626-152329648 GAAGGGAAACGAAGGGAGGAAGG + Intronic
1035046725 7:155972737-155972759 CAGGGAAGAGACAGGGAGGAAGG + Intergenic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1037251460 8:16900159-16900181 CAATGCAAACAAAGGGAAGAAGG + Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1038954102 8:32448680-32448702 CTGTGTAAACAATGGGAGGGAGG + Intronic
1039320755 8:36427861-36427883 AAGGGGAAAAAAAGGGGGGAAGG + Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1041275697 8:56155650-56155672 CAGGGTAGAGAAAAGGAGTAGGG + Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1042729690 8:71918548-71918570 TGGGGTAAAAAAAGGAAGGAAGG - Intronic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044875796 8:96665173-96665195 CAGGGTAAAGAATGGCAGAAAGG + Intronic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1045461055 8:102426210-102426232 CAGGGCAACCAATGGCAGGAAGG - Intergenic
1045615656 8:103907515-103907537 CAGAGAAAAAAAAGGAAGGAAGG - Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046818255 8:118608834-118608856 CAGCCTAAACAAAGACAGGAGGG + Intronic
1048722737 8:137345060-137345082 CAAGGGAAACAAAGGAAAGAAGG - Intergenic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050348915 9:4720910-4720932 CAAGGTAAACCAAGGTAGGCTGG - Intronic
1050515893 9:6444321-6444343 GATGGTAATCAAAAGGAGGAAGG + Intronic
1051082264 9:13307387-13307409 CAGGGAAATCAAAGAGGGGAGGG - Intergenic
1052161152 9:25261591-25261613 CAGTGTTATCAAATGGAGGATGG - Intergenic
1052644682 9:31218264-31218286 CACATTAAACAATGGGAGGATGG - Intergenic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1054771299 9:69086599-69086621 AAGGGGAAATAAAGGGATGAGGG - Intronic
1054945585 9:70792607-70792629 GAGGGGAAACAAAGGGAGACAGG + Intronic
1055009143 9:71544590-71544612 GAGAGTAAAGAATGGGAGGAAGG + Intergenic
1055542433 9:77325548-77325570 AAGAGAAAACAAAGGGAAGATGG - Intronic
1056217062 9:84415305-84415327 AAGGGAAATGAAAGGGAGGATGG - Intergenic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1057006171 9:91562171-91562193 CAGTGTCAAAAAAGGAAGGAAGG + Intergenic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1057349700 9:94285447-94285469 AAGGGGAAACAAAGGAGGGAAGG + Intronic
1058387881 9:104460189-104460211 CTGAGTGAACAAGGGGAGGATGG + Intergenic
1058850765 9:109010125-109010147 GAGGCTAAAAAATGGGAGGATGG - Intronic
1058927475 9:109681571-109681593 CAAGGTAAACAAGGGCAGGCTGG + Intronic
1058935821 9:109768198-109768220 CAGGGAGAAAAAAGGAAGGAAGG + Intronic
1059378917 9:113908340-113908362 CAGTTTAAAAAAATGGAGGAGGG + Intronic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1061612804 9:131759546-131759568 CAAGGAAAAAGAAGGGAGGAAGG + Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1203654155 Un_KI270752v1:7479-7501 CAGGGAAAACAAGGGAGGGAAGG + Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188177185 X:27005515-27005537 CACAGTAAACATAGGGATGAAGG + Intergenic
1188277316 X:28216061-28216083 CAAGGAAAAAAAAGGAAGGAAGG - Intergenic
1188874700 X:35415730-35415752 CATGGTCAACAAAGTCAGGAAGG + Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1191820665 X:65303212-65303234 GAGGGTAAAGGACGGGAGGAAGG + Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193515527 X:82457379-82457401 CAGAGAAACCAAAGTGAGGAGGG - Intergenic
1194008642 X:88530750-88530772 CAGGGGAAAAAAATGGAGGCGGG - Intergenic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196235903 X:113279281-113279303 CAGAATAAAGAAAGGAAGGAAGG + Intergenic
1196653298 X:118190524-118190546 AAGGGAAAAGAAAGAGAGGAAGG + Intergenic
1196992278 X:121343825-121343847 AAGGGTAAACAAAGGCAGTCTGG - Intergenic
1197391709 X:125875362-125875384 TAGGCTAAAAAAAGGGGGGATGG - Intergenic
1197562517 X:128041009-128041031 TAGCGTACACAAAGAGAGGAGGG - Intergenic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic
1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG + Intergenic
1197820773 X:130538839-130538861 AAGCCTAAACAAAGTGAGGAGGG + Intergenic
1197824793 X:130577387-130577409 CAGGTTAGAGAAAGGAAGGAAGG + Intergenic
1201256532 Y:12113049-12113071 AAGGGGAAACGAAGGGAGGGAGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic