ID: 947681701

View in Genome Browser
Species Human (GRCh38)
Location 2:232039716-232039738
Sequence CTTAATATTCCAATTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947681701_947681704 3 Left 947681701 2:232039716-232039738 CCTTTGTCAATTGGAATATTAAG 0: 1
1: 0
2: 0
3: 24
4: 271
Right 947681704 2:232039742-232039764 CTGTGAGAGTGACTGGTTTGAGG 0: 1
1: 0
2: 0
3: 18
4: 231
947681701_947681707 29 Left 947681701 2:232039716-232039738 CCTTTGTCAATTGGAATATTAAG 0: 1
1: 0
2: 0
3: 24
4: 271
Right 947681707 2:232039768-232039790 GAGAGTTTTTGGCAGAACCAGGG 0: 1
1: 0
2: 0
3: 18
4: 181
947681701_947681705 18 Left 947681701 2:232039716-232039738 CCTTTGTCAATTGGAATATTAAG 0: 1
1: 0
2: 0
3: 24
4: 271
Right 947681705 2:232039757-232039779 GTTTGAGGACTGAGAGTTTTTGG 0: 1
1: 0
2: 0
3: 18
4: 232
947681701_947681706 28 Left 947681701 2:232039716-232039738 CCTTTGTCAATTGGAATATTAAG 0: 1
1: 0
2: 0
3: 24
4: 271
Right 947681706 2:232039767-232039789 TGAGAGTTTTTGGCAGAACCAGG 0: 1
1: 0
2: 2
3: 96
4: 6524
947681701_947681703 -4 Left 947681701 2:232039716-232039738 CCTTTGTCAATTGGAATATTAAG 0: 1
1: 0
2: 0
3: 24
4: 271
Right 947681703 2:232039735-232039757 TAAGGTACTGTGAGAGTGACTGG 0: 1
1: 0
2: 1
3: 15
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947681701 Original CRISPR CTTAATATTCCAATTGACAA AGG (reversed) Intronic
900005908 1:51248-51270 CTTCATATTCAAATTGTCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903086092 1:20860730-20860752 CTACATATTCCAATAGCCAATGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
907014474 1:50998595-50998617 TTTAATAATCCAATTAAAAATGG + Intergenic
908610518 1:65854650-65854672 CTTCATATTTAAATTGCCAAAGG - Intronic
909497406 1:76293706-76293728 CTTTATCTTCTAATTGACAGTGG - Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910491439 1:87776856-87776878 CTTAATATTGCCTTTGACATTGG + Intergenic
910751570 1:90636824-90636846 CTGAATATTCCTATTTACACTGG + Intergenic
911972308 1:104453698-104453720 CTTTATATGCCAATTGTGAATGG + Intergenic
912577695 1:110689213-110689235 ATAAATATTGCAATTTACAATGG - Intergenic
913096230 1:115518526-115518548 TCTAATATTCCAATTAAAAATGG - Intergenic
913283631 1:117208525-117208547 CTGAATATTGCACTAGACAATGG - Intronic
913484293 1:119319730-119319752 ATTAATATTACAATTGCAAAAGG - Intergenic
913485366 1:119328336-119328358 CTTAAAACTCCCATTGACATGGG - Intergenic
915026414 1:152834636-152834658 CTTAGGAATCCAACTGACAAGGG + Intergenic
917519809 1:175738687-175738709 GATAATATGCCAATTGGCAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917780789 1:178393917-178393939 TTTAATATTCCATTTGACTAGGG - Intronic
917880668 1:179332820-179332842 CTTAATATTCCCTCTTACAAAGG + Intronic
918151934 1:181804646-181804668 ATTCATGTTTCAATTGACAAGGG - Intronic
918610317 1:186482556-186482578 CTTAATATGCTAATAGAGAATGG - Intergenic
922045682 1:221943621-221943643 AATAATAATGCAATTGACAAAGG + Intergenic
922885982 1:229020927-229020949 CTAAGTATTTCAATTGATAAGGG + Intergenic
924077240 1:240352937-240352959 CTGAATAATCCCAGTGACAAAGG + Intronic
924862462 1:247937902-247937924 TTTAATTTTCCAATTGTGAAAGG - Intronic
1064608926 10:17076638-17076660 CATAATCTTCCCATTGACTATGG + Intronic
1069660237 10:70118727-70118749 CTTAGTACCCCAATTTACAAGGG - Intronic
1073306701 10:102508558-102508580 CTTATCATTGCAAGTGACAAAGG - Intronic
1074009332 10:109460719-109460741 TTTAATATTCCATTTGAGGAAGG + Intergenic
1079166500 11:18048831-18048853 TTTAATAATCCAATTAAAAATGG + Intergenic
1079875643 11:25853624-25853646 CTTTGTATTTCAATTGCCAAAGG - Intergenic
1080086890 11:28293774-28293796 CTTAGGAATCCAACTGACAAAGG - Intronic
1080246306 11:30182866-30182888 CCTAGGAATCCAATTGACAAGGG + Intergenic
1082899212 11:58227652-58227674 CCTAATATGGCAATTGACATAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087603392 11:100344051-100344073 TTTAATATTCCAATTAAGTATGG - Intronic
1087966200 11:104419148-104419170 CTTAATATTCTCATTGACACTGG - Intergenic
1088933002 11:114371093-114371115 TTTAATATTCAAATTGACCCTGG - Intergenic
1089173638 11:116533403-116533425 CTCAATTTTCCAATTGCCACTGG + Intergenic
1091513116 12:1150559-1150581 CTTAAGATTCCTAATGAGAATGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094290856 12:28848140-28848162 CTTTATAATCCAAATCACAAAGG - Intergenic
1095133838 12:38573635-38573657 CTTAATAATCAAATTCTCAAAGG + Intergenic
1095185274 12:39193993-39194015 CTTAAGAATCCAAGTTACAAGGG - Intergenic
1095270103 12:40208563-40208585 CTTAATTTTCCAAATGCTAATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095813705 12:46398618-46398640 CCTAATAATCCAACTTACAAGGG + Intergenic
1097534445 12:60848713-60848735 TTTAATATTCTAATTGAGCAAGG + Intergenic
1097740212 12:63233214-63233236 ATTAATAATCCAGTTGAGAAAGG - Intergenic
1099840736 12:87962536-87962558 CCAAATATTCCAATTAAAAATGG - Intergenic
1101221398 12:102644919-102644941 CCTCATATTCCAAATGACATGGG + Intergenic
1103197035 12:119053272-119053294 CTTCATATTACAATTGTAAATGG - Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106860379 13:33900855-33900877 TATAATAATCCAATTGAAAATGG + Intronic
1107112746 13:36715623-36715645 TTTAATATTACATTTGACAAAGG + Intergenic
1107652183 13:42556366-42556388 CTTAGGAATCCAATTTACAAGGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108474659 13:50801901-50801923 ATTATTATACCAATTGAAAATGG - Intronic
1109287074 13:60422182-60422204 CTTCATTATCCAATTGCCAAAGG - Intronic
1109484361 13:62998893-62998915 CATATTATTCCAATTACCAAAGG + Intergenic
1109747840 13:66649258-66649280 CTTAATAATCAAATTGTCAAAGG + Intronic
1110570269 13:76995421-76995443 CATAATATTACAATGGATAATGG - Intronic
1111323089 13:86655985-86656007 CTCAAGTTTCCATTTGACAATGG + Intergenic
1111502157 13:89135908-89135930 CTACATATTCCAAATGACAATGG + Intergenic
1111803927 13:93014955-93014977 CATAATATACCAATTGATAGGGG + Intergenic
1112878869 13:104081521-104081543 CTTAGGAATCCAATTTACAAGGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114433610 14:22684620-22684642 TTTAATAATCAAATTGCCAAAGG + Intergenic
1114909556 14:27173108-27173130 CATTATAGTCAAATTGACAAGGG - Intergenic
1115482719 14:33877671-33877693 CTTAATTTTCTAATTAAGAATGG - Intergenic
1115678421 14:35708414-35708436 ATTAATAATCCAATTAAAAATGG + Intronic
1116370456 14:44123915-44123937 CTTAATATTACTATATACAAAGG - Intergenic
1116570805 14:46512993-46513015 CTTAAGAATCCAACTTACAAGGG + Intergenic
1116727361 14:48577265-48577287 CATCATATTCCCAGTGACAAAGG + Intergenic
1118240905 14:64057947-64057969 ATTAATAATCCAATTAAAAATGG - Intronic
1118604692 14:67494261-67494283 ATTAACATTCCTTTTGACAAAGG + Intronic
1120100296 14:80436811-80436833 CTTAATAATCAAATTCCCAAAGG + Intergenic
1120516764 14:85480273-85480295 TTTAATTTTCCAAATGATAAAGG + Intergenic
1123905906 15:24921106-24921128 CATAATATTCCACTTGGCCAAGG + Intronic
1126347592 15:47712553-47712575 CTCAAAATTCAAACTGACAAAGG - Intronic
1126587424 15:50302957-50302979 TTTGATATTTCAATAGACAATGG - Exonic
1128410521 15:67392425-67392447 CTCAATGTTCCATTTGACAATGG - Intronic
1130632703 15:85584866-85584888 CTTAATAATCCAAATGCAAATGG - Intronic
1130891733 15:88139218-88139240 CTTAATAATCCCATTGAGAGGGG - Intronic
1131595759 15:93796643-93796665 CTTAGGAATCCAATTAACAAGGG + Intergenic
1131697470 15:94893720-94893742 CTCAATATTGACATTGACAATGG - Intergenic
1132447606 15:101939675-101939697 CTTCATATTCAAATTGTCAAAGG - Intergenic
1134160274 16:11882450-11882472 CTAAATATTACATTTGATAATGG + Intronic
1136646953 16:31629278-31629300 CTTATGATTCCATTTAACAAAGG + Intergenic
1136658227 16:31726999-31727021 CTTATGATTCCATTTAACAAAGG - Intronic
1138901657 16:61277708-61277730 CTTAATATTCACATTGACTTTGG - Intergenic
1144204423 17:12969449-12969471 CATATTATTCCATTTTACAAAGG + Intronic
1144277125 17:13681522-13681544 CTCAATATTTCAAATGACAGAGG + Intergenic
1146136724 17:30328474-30328496 CTTACAATTCAAAATGACAAAGG + Intronic
1147049584 17:37782401-37782423 CTTAAGAATGCAATTAACAAGGG - Intergenic
1149354160 17:55822490-55822512 TGAAATATTCCAACTGACAAAGG - Intronic
1153363745 18:4229643-4229665 CTTAATATGGCAAGAGACAAGGG - Intronic
1156298387 18:35813826-35813848 CCTAAGAATCCAATTTACAAGGG + Intergenic
1156533084 18:37836736-37836758 CCTAATTCTCCAGTTGACAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157272078 18:46283763-46283785 CTTAATATTTCAGTTGCCACAGG - Intergenic
1157492628 18:48135140-48135162 ATTACTATTCCCATTGACAGAGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159255730 18:65943029-65943051 CTAAACATTTCAATTCACAAAGG - Intergenic
1159805441 18:72952246-72952268 CTTAAAATTCCATGTGTCAAGGG + Intergenic
1160128039 18:76196944-76196966 GTTAATATTAATATTGACAAAGG - Intergenic
1160637665 19:92854-92876 CTTCATATTCAAATTGTCAAAGG + Intergenic
1162289170 19:9765774-9765796 CTTAATACTCTAATTGTCCAGGG + Intronic
1162699701 19:12504779-12504801 CTTCATTTTCCAATTCACAGTGG + Intronic
1166576506 19:43844478-43844500 CCTAATATTCCAACTGAATATGG - Intronic
1202653750 1_KI270707v1_random:30106-30128 CTTAGGAATCCAATTTACAAGGG + Intergenic
928872859 2:36001218-36001240 CTTAACATTCTGAATGACAAGGG + Intergenic
930297388 2:49571896-49571918 TCTAATAATCCAATTGAAAATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933920745 2:87042426-87042448 CTTAATTTTCTAACTGACAGAGG + Intergenic
933930880 2:87151360-87151382 CTTAATTTTCTAACTGACAGAGG - Intergenic
934002253 2:87727473-87727495 CTTAATTTTCTAACTGACAGAGG - Intergenic
936362241 2:111814082-111814104 CTTAATTTTCTAACTGACAGAGG + Intronic
936594532 2:113835245-113835267 TTTTTTATTCCAATTGAAAATGG - Intergenic
937615109 2:123912660-123912682 GTAAATTTTCCAAGTGACAATGG + Intergenic
938999507 2:136717777-136717799 CTGAATATTCCAATAGATGATGG - Intergenic
939074500 2:137584056-137584078 CCTAGGATTCCAATTTACAAGGG - Intronic
939110467 2:138000574-138000596 CTTAAAATTTTAATTGACAGTGG + Intronic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940339687 2:152567203-152567225 CATTATATTCCATTTGTCAAAGG - Intronic
940690121 2:156906239-156906261 TTTAATATTCAAAATGACATTGG - Intergenic
940803220 2:158155790-158155812 CTTAATAATCCAACTCCCAAAGG + Intergenic
940841092 2:158582751-158582773 ATTTATATTCCATTTAACAATGG - Intronic
940862423 2:158784524-158784546 CTTAATAGTCCAAGGGGCAAGGG + Intergenic
942005010 2:171689125-171689147 CTTAACATTACAATTGACACTGG - Intronic
942584773 2:177463745-177463767 CTTAATAATCCAATAGCAAAAGG - Intronic
942748057 2:179258507-179258529 CTTTACAAACCAATTGACAAAGG + Intronic
943610781 2:190031493-190031515 CTTTATTTTTCACTTGACAATGG + Intronic
943987647 2:194643193-194643215 CCTAATAATCCAACTTACAAGGG + Intergenic
946125506 2:217559041-217559063 CTTAATTTTCTAATTGAGAAAGG - Intronic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
948132901 2:235613955-235613977 CACAATATTCCCATTAACAAAGG - Intronic
1170502497 20:16989045-16989067 TTAAATCATCCAATTGACAATGG + Intergenic
1172948250 20:38704856-38704878 ATTCATATTCCATTTTACAAAGG - Intergenic
1174638337 20:52021109-52021131 CTTCAGATTCCAAAGGACAATGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176598385 21:8769158-8769180 CTTAGGAATCCAATTTACAAGGG - Intergenic
1178333742 21:31725459-31725481 CTTAATGTACGAATTGACATTGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178969549 21:37159997-37160019 ATTAATATTCTAATTAAGAAAGG + Intronic
1180377445 22:12107530-12107552 CTTAGGAATCCAATTTACAAGGG - Intergenic
1180420059 22:12805740-12805762 CTTAGGAATCCAATTTACAAGGG + Intergenic
1181547901 22:23613916-23613938 CTCAGTATTCCAGTTGATAATGG + Intronic
1182041382 22:27241391-27241413 TTTAGTATCCCCATTGACAATGG - Intergenic
950993440 3:17466829-17466851 CTTAATATTCCTGTTGAAGATGG - Intronic
951268919 3:20602176-20602198 CTGAACATTCCCATTGGCAATGG - Intergenic
954233964 3:49241310-49241332 TTTGATTTTCCAACTGACAAAGG - Exonic
954542281 3:51401670-51401692 CTTTATATTCAAATTAAGAATGG + Intronic
954719759 3:52551444-52551466 CTTTATATGCAAAATGACAAAGG + Intronic
955273438 3:57524910-57524932 CTTTTTAATCCAATAGACAATGG + Intronic
956884057 3:73540967-73540989 CTTACTGTTACAAATGACAAAGG + Intronic
957116287 3:76031085-76031107 CCTAAGAATCCAATTCACAAGGG - Intronic
958553022 3:95641066-95641088 GTTAATATTCCAATTTCCAAAGG + Intergenic
959080557 3:101796359-101796381 CTTAATTTTCCTAAAGACAAGGG - Intronic
960145119 3:114192714-114192736 CTACTTATTCCAATTGTCAATGG + Intronic
960524128 3:118690267-118690289 CTGTTTATTCCAATTCACAATGG - Intergenic
963352795 3:144172933-144172955 CTTAATAAGCCAATTGGCGACGG - Intergenic
963701593 3:148632475-148632497 CTTAATAATCAAATTCCCAAAGG + Intergenic
964736177 3:159920867-159920889 TTTAATTTTACAATTGACATGGG + Intergenic
965406692 3:168277728-168277750 CCTAATATCCCCATTCACAATGG - Intergenic
966050456 3:175611710-175611732 CTTTATATTTTAATTTACAAAGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967392119 3:188966783-188966805 CTTACAAATCCAATTTACAAGGG - Intronic
969747476 4:9084945-9084967 CTTAGGAATCCAATTTACAAGGG + Intergenic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
970574881 4:17417494-17417516 CTTTCTATTGCAATTGACCAGGG + Intergenic
971490489 4:27207098-27207120 TATTATATTCCAATTGAGAAAGG - Intergenic
971647116 4:29221039-29221061 ATTGCTATTCCAATTCACAATGG - Intergenic
972125572 4:35760834-35760856 CTAAATGTTCCCATTGGCAATGG + Intergenic
973361715 4:49171527-49171549 CTTAGGAATCCAATTTACAAGGG - Intergenic
973399375 4:49625334-49625356 CTTAGGAATCCAATTTACAAGGG + Intergenic
974649313 4:64733732-64733754 CATAATATCACAATTGAGAAAGG + Intergenic
975248210 4:72144878-72144900 CTCAGTATTCCAAGTGGCAAAGG - Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976953858 4:90869035-90869057 CTTAATAATCCAATTAAACATGG - Intronic
977143220 4:93402067-93402089 CTTAATATACCTTTTAACAAAGG + Intronic
977806335 4:101302725-101302747 ATTATCATTCCAATTGAGAAAGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979729762 4:124010107-124010129 CTTAGGAATCCAACTGACAAGGG - Intergenic
979735801 4:124082032-124082054 CTAAATATCACAATAGACAAAGG + Intergenic
979993698 4:127406098-127406120 TTTAATTTTCAAATTTACAAAGG - Intergenic
980838247 4:138224460-138224482 CTTATTATTCAAATTGAAATTGG + Intronic
981690557 4:147504473-147504495 TTTAATATTCCACGTGACAAAGG - Intronic
981849872 4:149217883-149217905 ATAAATATTCCCATTCACAAAGG - Intergenic
984438926 4:179740822-179740844 CTAAATATTCCATTTGAAAGAGG - Intergenic
985254863 4:188059593-188059615 ATTAAGATTCCAATTGAAGATGG - Intergenic
1202759053 4_GL000008v2_random:92989-93011 CTTAGGAATCCAATTTACAAGGG - Intergenic
986776875 5:11023758-11023780 CTTACTATTCCCAATGACAAAGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986813986 5:11387818-11387840 CTTAATATTCTCATTTACATTGG - Intronic
986977989 5:13414747-13414769 CTTAATATTACATTGGACCAAGG - Intergenic
987519565 5:18963024-18963046 CTTAACATTCCAAATGAATAGGG + Intergenic
988977244 5:36527364-36527386 CTTAACATTCATATTGCCAAAGG - Intergenic
989271922 5:39543874-39543896 GTGAAAATTCCAATTGAAAATGG - Intergenic
989330393 5:40251587-40251609 CTTAATATTCCATTTCACTAAGG - Intergenic
990102408 5:52208060-52208082 CTTAATATTTCAAATTTCAAGGG + Intergenic
995092677 5:108197011-108197033 CTCAATATACCAATTCAGAATGG + Intronic
995096543 5:108241700-108241722 TTTAATAATCAAATTCACAATGG + Intronic
998848738 5:146335107-146335129 AATAATAATCCAAGTGACAAGGG + Intronic
999772394 5:154785438-154785460 GCTAATATTACAATTCACAAAGG - Intronic
1000464938 5:161564261-161564283 CTCAAGATTCCAATTCAGAATGG + Intronic
1003139776 6:3460963-3460985 CTTGATATTCCAAAAGGCAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005661315 6:28001930-28001952 CTTAATGGACCATTTGACAACGG + Intergenic
1006861866 6:37177154-37177176 CTTAATATATGAATTGACAATGG - Intergenic
1007875717 6:45098596-45098618 CATAATATTCTGATTGGCAAGGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009325033 6:62338815-62338837 CTGAATATTCCTATTGGCAATGG + Intergenic
1009800909 6:68535109-68535131 CTTAATATTTCAAATTACACTGG - Intergenic
1010858500 6:80873888-80873910 TTTAAAATTCAAAATGACAACGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011873131 6:91922000-91922022 CCTTATACTTCAATTGACAATGG - Intergenic
1012672273 6:102069076-102069098 CTTTATATTCCAACTGCCATGGG - Exonic
1014785048 6:125609375-125609397 CCTAAGAATCCAACTGACAAAGG + Intergenic
1015000894 6:128213872-128213894 CTTAATAACCCACTTGACAAAGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016921717 6:149301362-149301384 CTTAATACTCCAGTTTATAATGG - Intronic
1017326966 6:153151183-153151205 CTTAATGGACCATTTGACAACGG + Intergenic
1018588949 6:165395025-165395047 CTAAATATTCCAATAAAAAAGGG - Intronic
1020562649 7:9749356-9749378 GTTAATATTCTAAATGACTATGG + Intergenic
1020770227 7:12382046-12382068 ACTAATATTACAATTGACAAAGG - Intronic
1021543361 7:21785195-21785217 CTTAAGATTCCATTTCAAAAAGG + Intronic
1021998849 7:26205607-26205629 ATTAATATTTGAATTGAGAAGGG + Intronic
1023126998 7:36964524-36964546 CTTAAGTTTCCAAATTACAATGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024509682 7:50193852-50193874 GTTAATTTGCCAATTGCCAATGG - Intergenic
1024970122 7:55061424-55061446 CTTAAAATTCACATTGACATGGG - Intronic
1026124370 7:67566673-67566695 GTTATTATTGCAATTAACAAAGG + Intergenic
1026407125 7:70077953-70077975 TTTAATATTCAGATTGACAGTGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029134065 7:98355875-98355897 CTTAATTTTTCTATTGAAAAAGG + Intronic
1029880647 7:103806112-103806134 CTTAATTTTTCAGGTGACAAGGG + Intronic
1031215801 7:118888941-118888963 TCTAATAATCCAATTAACAATGG + Intergenic
1031837351 7:126693954-126693976 CTTAAAATAGCAATTTACAAAGG - Intronic
1031847844 7:126827432-126827454 CTTAGGAATCCAATTTACAAGGG - Intronic
1032067979 7:128786405-128786427 TATAATATTCCAATAGATAATGG + Intergenic
1033052641 7:138020458-138020480 CTAAATATTCCCTTTAACAAAGG - Intronic
1033087061 7:138352483-138352505 CCTAATATTCCAAAAGAAAATGG + Intergenic
1034779710 7:153867368-153867390 CTTAGGAATCCAATTTACAAGGG - Intergenic
1037697663 8:21240207-21240229 CCAAATAATCCAATTGAAAATGG - Intergenic
1038578129 8:28722848-28722870 CTTGATATTCAAATTGAACAGGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039348083 8:36730178-36730200 CTTAGGATTCCAACTTACAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041385077 8:57292645-57292667 CCTAGGATTCCAATTTACAAGGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041448544 8:57981565-57981587 CTTATTAGTAAAATTGACAAGGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1047814537 8:128448439-128448461 CTCAATATACCAACTGCCAATGG + Intergenic
1048242761 8:132760318-132760340 CCTCTTCTTCCAATTGACAAAGG + Intronic
1050077779 9:1882721-1882743 GTTAAAATTCCAAATGATAAAGG - Intergenic
1050830727 9:10008765-10008787 CATGATACTTCAATTGACAAGGG + Intronic
1050897457 9:10901122-10901144 CCTAAGAATCCAATTTACAAGGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051826066 9:21221639-21221661 CTTAGGAATCCAACTGACAAGGG + Intronic
1052258573 9:26488965-26488987 TTTAATAATCAAATTGCCAAAGG - Intergenic
1052292330 9:26856904-26856926 CTTAATTTTTGAATTTACAAAGG + Intronic
1052557428 9:30034935-30034957 TTTAATATATGAATTGACAAAGG - Intergenic
1053204852 9:36177324-36177346 CTTAATAATCCAACTCTCAAAGG + Intergenic
1058185560 9:101850226-101850248 GTTAATATTCCAACTGTCAGTGG - Intergenic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058834744 9:108851133-108851155 CTTAATATTTCAATTAAAAGAGG + Intergenic
1058962150 9:110001732-110001754 CTTAGGAATCCAATTTACAAGGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059890807 9:118800907-118800929 CTTTATATTCAAAATGAAAATGG + Intergenic
1203690843 Un_GL000214v1:41214-41236 CTTAGGAATCCAATTTACAAGGG - Intergenic
1203539836 Un_KI270743v1:77888-77910 CTTAGGAATCCAATTTACAAGGG - Intergenic
1203554860 Un_KI270743v1:197952-197974 CTTAGGAATCCAATTTACAAGGG + Intergenic
1203645452 Un_KI270751v1:62977-62999 CTTAGGAATCCAATTTACAAGGG + Intergenic
1187555056 X:20343667-20343689 CTTAAAGTTCCACTTGACTAGGG - Intergenic
1187687587 X:21830974-21830996 ATTAATACACCAATTGACAGTGG - Intergenic
1188083321 X:25872727-25872749 CATAATATTTCAATCAACAATGG + Intergenic
1188372599 X:29386991-29387013 CTTAAATTTCCAATTCAAAAAGG - Intronic
1192857846 X:75032951-75032973 CTTAGGAATCCAATTTACAAGGG - Intergenic
1193219851 X:78911665-78911687 TTTAATAATCAAATTGTCAAAGG - Intergenic
1193243985 X:79207418-79207440 CTTAAGAATCCAACTTACAAGGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194532689 X:95070607-95070629 TTTAATAATCCAATTCCCAAAGG + Intergenic
1194551322 X:95303817-95303839 TTTAATACTCCAATTAATAATGG + Intergenic
1196083077 X:111654413-111654435 TTTTATAATCCATTTGACAAAGG + Intergenic
1196247563 X:113417322-113417344 TTTAATAATCCAACTCACAAAGG + Intergenic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1196882040 X:120207386-120207408 CTTAATAGACCACTTGACAATGG + Intergenic
1197079595 X:122396346-122396368 CTTAAGAATCCAACTTACAAGGG + Intergenic
1198173160 X:134127888-134127910 CTCATTATTCCAATTGAAATTGG - Intergenic
1199333021 X:146583860-146583882 AATAATATTCCAATTTAAAATGG - Intergenic
1199362587 X:146940689-146940711 CTTAATAATCCAACTCTCAAAGG - Intergenic
1201337183 Y:12893645-12893667 CTTAATTTTCCAGCTGACAGAGG + Intergenic