ID: 947682111

View in Genome Browser
Species Human (GRCh38)
Location 2:232044322-232044344
Sequence ACTGTGACTTCATCTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947682111_947682114 -1 Left 947682111 2:232044322-232044344 CCAGTGAGAGATGAAGTCACAGT 0: 1
1: 0
2: 2
3: 18
4: 196
Right 947682114 2:232044344-232044366 TGCCCATGTGGAATACAAGGAGG 0: 1
1: 0
2: 0
3: 14
4: 135
947682111_947682113 -4 Left 947682111 2:232044322-232044344 CCAGTGAGAGATGAAGTCACAGT 0: 1
1: 0
2: 2
3: 18
4: 196
Right 947682113 2:232044341-232044363 CAGTGCCCATGTGGAATACAAGG 0: 1
1: 0
2: 0
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947682111 Original CRISPR ACTGTGACTTCATCTCTCAC TGG (reversed) Intronic
900110831 1:1004906-1004928 ACTTTGACTTCCTCTCTTTCAGG + Intergenic
902281158 1:15375463-15375485 ACTGTGTCCTCATCTGCCACGGG + Intronic
902673424 1:17992005-17992027 CCTGTGACATCGTCTCTCAAAGG - Intergenic
902822024 1:18949270-18949292 ACTCTGGCTTCGTCTCCCACTGG - Intronic
903196220 1:21690446-21690468 ACTGTCACCTCATCTTTCCCAGG + Intronic
903335108 1:22619391-22619413 CCTGTGGTTTCATCACTCACTGG + Intergenic
905363768 1:37437674-37437696 ACTGTGAGTTCATCTTTGAGGGG - Intergenic
905478028 1:38242598-38242620 AGAGTGACTGCATCTCTGACGGG - Intergenic
906849504 1:49233170-49233192 ACTTTGACTTCATAAATCACAGG + Intronic
907611581 1:55876345-55876367 ACTGAAACTTCAGCTCTTACAGG + Intergenic
907636532 1:56140691-56140713 AGTGAGTTTTCATCTCTCACAGG + Intergenic
909837235 1:80271911-80271933 ACTGTGACTTCATCTTTTTCTGG - Intergenic
911546836 1:99227474-99227496 TCTGTGCCTACATCTCTCATTGG - Intergenic
912014648 1:105017741-105017763 CCCGTGATTTCATCTCTGACCGG - Intergenic
916253158 1:162758274-162758296 ACTCTGATGTCATCTCTCAGTGG - Intronic
917019986 1:170575873-170575895 ACTGTGACATCAACCCTAACAGG + Intergenic
918538538 1:185602610-185602632 GCTGTGTCTTCTTCTCTCAAAGG - Intergenic
921657163 1:217753239-217753261 ACTGTTACTTCACCTCTGAGTGG + Intronic
924672232 1:246140772-246140794 AGTGAGACTCCATCTCTAACGGG - Intronic
1062984391 10:1754448-1754470 ACTGCGACTTTGTTTCTCACAGG - Intergenic
1063115764 10:3070143-3070165 ATTGTGACTTCAGCTCTGCCAGG - Intronic
1063372193 10:5529184-5529206 AGTATGAATGCATCTCTCACCGG + Intergenic
1063929032 10:11010599-11010621 CCTGTGACTTTACCTCTCTCGGG - Intronic
1067055702 10:43048634-43048656 ACTGTGACCTCATCTCTTGTTGG + Intergenic
1070405293 10:76089176-76089198 TCAGTGATTTCATCTGTCACAGG - Intronic
1071533026 10:86403206-86403228 CCTGTGACTTCATCCTGCACTGG + Intergenic
1073864702 10:107788075-107788097 AGTGTGAATTCATTTCTCATGGG + Intergenic
1074019770 10:109570470-109570492 ACTGTCACTACATCTGTTACTGG + Intergenic
1074842849 10:117373307-117373329 ACTGTAAGTTCTTCTCTCAAGGG - Intronic
1078032134 11:7763702-7763724 ACTTTGGCTTCATGTCTCAAAGG - Intergenic
1082313153 11:50680091-50680113 TCTGTGCATTCATCTCTCAGAGG + Intergenic
1082964665 11:58954710-58954732 ACTTTTTCTTCACCTCTCACTGG - Intronic
1084334697 11:68449887-68449909 ACTGTGCCTTCATTTTTCACTGG + Intergenic
1090341400 11:126024353-126024375 ACTGTGTCCTCATCTGTCTCCGG - Intronic
1090763938 11:129860792-129860814 GCTGTGACTTCAACTCTGAAAGG - Intergenic
1091171187 11:133521039-133521061 TCTGTGACTTCCTCTCTCTCTGG - Intronic
1092145556 12:6212262-6212284 CCTGTTTCTTCATCTCTCACAGG + Intronic
1092282984 12:7111040-7111062 ACTGGGACCTCGTCTCTAACTGG + Intergenic
1093297741 12:17411888-17411910 GCTGTGCCTTCATGTATCACTGG + Intergenic
1095067974 12:37806354-37806376 AGTGTGCCTTCATCTCACAGTGG + Intergenic
1095617463 12:44208415-44208437 CCTGTGAATACCTCTCTCACAGG - Intronic
1096983565 12:55742931-55742953 TCTGTCTCTTCATCTCTCTCTGG + Intergenic
1098462405 12:70746209-70746231 ACTGAGAAATCATCTCTCAGAGG - Intronic
1099115830 12:78623003-78623025 ACAGTGACTTCAGCTGTGACAGG - Intergenic
1099182347 12:79483163-79483185 ACTGTGACTTGAGCTCACCCCGG + Intergenic
1100193559 12:92218996-92219018 TCTGTCACCTCATCTCTCACTGG + Intergenic
1102728950 12:115091048-115091070 TCTCCAACTTCATCTCTCACTGG - Intergenic
1106020164 13:25906628-25906650 TCTGTGAGTACATCTGTCACAGG + Intronic
1106413450 13:29526651-29526673 TCTGTGAGTTCATCTCTTTCTGG - Intronic
1108935672 13:55877699-55877721 ACTGTCACTTCTTCTCCCTCAGG + Intergenic
1109501955 13:63249511-63249533 GCTGAGGCTTCATTTCTCACAGG - Intergenic
1112820866 13:103333285-103333307 ACTGGGAATGCGTCTCTCACAGG + Intergenic
1113545427 13:111145461-111145483 CCTGTAACTACAGCTCTCACTGG - Intronic
1117341349 14:54794988-54795010 ACAGTCACTACATCTATCACTGG + Intergenic
1119458548 14:74778558-74778580 ACTGTAACTTCTTCTTTTACCGG - Exonic
1119965425 14:78910250-78910272 ACTCTGCCTCCACCTCTCACTGG + Intronic
1120471199 14:84927278-84927300 ATTGTGATTTCACCTCTTACAGG + Intergenic
1121989841 14:98545823-98545845 ACCGAAACTTCATCTCTCACAGG - Intergenic
1124085984 15:26551054-26551076 ACAGTGACCTCATCTGTCTCAGG - Intronic
1126712899 15:51481316-51481338 AGCCTGACTTCATTTCTCACAGG - Exonic
1126757440 15:51938409-51938431 ACTGTGAACTAATCTCTCACAGG + Intronic
1127889858 15:63240240-63240262 ACTGTGCCAACATCTCTCCCTGG - Intronic
1128093223 15:64933144-64933166 ACGGTGACTGCATTTCCCACTGG + Intronic
1128212814 15:65914131-65914153 ACTGTGCCTTCATCCCTAAAGGG + Intronic
1129301524 15:74628387-74628409 GCTGTGACTACATTTCTCTCTGG - Intronic
1129838636 15:78729804-78729826 TCTGTGACTGCATCGCTCAGGGG + Intergenic
1130125927 15:81094206-81094228 ACTGGGGCTTCATCTCTCTGGGG - Intronic
1131705093 15:94984997-94985019 CGTGTGACTTCATCTCTAAAGGG + Intergenic
1134259819 16:12642113-12642135 TCTGTGACTTAATCTCTTCCTGG + Intergenic
1134877945 16:17718928-17718950 TCTCTGACATCATCTCTCAGAGG + Intergenic
1135383900 16:22019153-22019175 TCAGTGACTTCATCTTCCACAGG + Intronic
1135507487 16:23051505-23051527 ACAGTGACTTCTGCCCTCACTGG + Intergenic
1138825070 16:60309084-60309106 CCTGTGATTTCATCTCTGATTGG - Intergenic
1140040882 16:71406922-71406944 ACTGTGACCACAACACTCACAGG + Intergenic
1140101477 16:71921591-71921613 AATGTGCCTGCATATCTCACAGG + Intronic
1140432346 16:74915119-74915141 GCTGTGCCATCTTCTCTCACAGG - Intronic
1140800970 16:78488027-78488049 ACTGGGACCTCTTCTCTCTCAGG + Intronic
1141901054 16:86990815-86990837 ACTGTGACTTCCTTTCTCTGTGG - Intergenic
1145412013 17:22674770-22674792 TGTGTGAATTCATCTCCCACAGG - Intergenic
1148162992 17:45462257-45462279 ACTGACACATCATCTGTCACTGG - Intronic
1148663777 17:49359830-49359852 ACTGTGATTTCATGTCTTAATGG - Intronic
1148855017 17:50574334-50574356 ATTTTGTCTTCATCTCTCTCTGG - Intronic
1150181101 17:63121951-63121973 AGTGAGACTTCATCTCTTGCGGG + Intronic
1150394223 17:64808912-64808934 ACTGACACATCATCTGTCACTGG - Intergenic
1150637092 17:66920978-66921000 TCGATGACTTCATCTCTTACTGG - Intergenic
1151232549 17:72695145-72695167 ACTCTGACCTCATCTCCCAGAGG + Intronic
1152685129 17:81690161-81690183 ACTATGGCTTCATCTCTCCAGGG + Exonic
1153816105 18:8791456-8791478 TGTGTGACTTCATCTCCCAGGGG - Intronic
1158983351 18:62787710-62787732 ACTTTGCCTTCATATTTCACTGG + Intronic
1159065351 18:63563064-63563086 TGTGTGACTTCAGCTCTCCCTGG + Intronic
1160209001 18:76860388-76860410 ACTGTGATTTCCTCCATCACTGG + Intronic
1163346246 19:16744399-16744421 TCTGTGACTTCCTCTCTGCCAGG + Exonic
1165949361 19:39465317-39465339 ACTGTGCCATCCTATCTCACAGG - Intronic
1166007295 19:39916379-39916401 ACTGTGGCTTCCTCTCACTCAGG + Intronic
1166772438 19:45291934-45291956 GCTTTGACTTCAGCTCACACAGG - Intronic
1166938534 19:46349539-46349561 CCTCTGGCCTCATCTCTCACTGG - Intronic
1167262010 19:48464006-48464028 TCTCTGACTTCCTCTCTCTCTGG + Intronic
1168133518 19:54336311-54336333 ACTGCGCTTTCATCTCCCACGGG + Intronic
925453989 2:3998497-3998519 ACTTTGACTTCATGTCTCATAGG - Intergenic
925954264 2:8946596-8946618 GCTGAGACTTCATGTCTCTCTGG + Intronic
928008075 2:27581686-27581708 ACTGTGATGTCTTCTCTCAGAGG - Exonic
928008091 2:27581806-27581828 ACTGTGATGTCTTCTCTCAGAGG - Exonic
928008101 2:27581902-27581924 ACTGTGATGTCTTCTCTCAGAGG - Exonic
928008109 2:27581974-27581996 ACTGTGACGTCTTCTCTCAGAGG - Exonic
928008157 2:27582283-27582305 ACTGTGACGGGTTCTCTCACAGG - Exonic
933097592 2:78206572-78206594 ACTGTGAATTCATCTTATACTGG - Intergenic
933416254 2:81990262-81990284 AGTTTCTCTTCATCTCTCACAGG - Intergenic
935339988 2:102051334-102051356 ATTGTGATTTCTTCTCTCAGCGG + Intergenic
936881520 2:117257549-117257571 ACTGTGAATTCATCCATCCCAGG - Intergenic
938419835 2:131136238-131136260 AGTGAGACCTCATCTCTCAGGGG - Intronic
940217635 2:151316565-151316587 ACTTGGACTTCATCTTTCTCTGG - Intergenic
942129045 2:172859887-172859909 ACTCTGACTTCCTGTCTCAATGG + Intronic
943330731 2:186555876-186555898 GCTGTGTCCTCTTCTCTCACAGG - Intergenic
946892544 2:224293151-224293173 ACTGTGACTTCATCTGTCCTTGG + Intergenic
946975745 2:225148220-225148242 TCTAAGACTTCACCTCTCACTGG + Intergenic
947166553 2:227268143-227268165 TCTGTAACTTCACCTCTCAATGG - Intronic
947682111 2:232044322-232044344 ACTGTGACTTCATCTCTCACTGG - Intronic
1168953963 20:1821273-1821295 ACTGTAGCTTCATCTCTCACCGG + Intergenic
1169507777 20:6231685-6231707 ATTCAGACTCCATCTCTCACTGG - Intergenic
1170665757 20:18384701-18384723 ACAGTGACTTCAGTTCTCAGAGG + Intronic
1170926834 20:20732795-20732817 CCTGGGATTTCACCTCTCACTGG - Intergenic
1171169178 20:23000371-23000393 CCTGTGACTTCATCTTCCAAAGG + Intergenic
1172014755 20:31866683-31866705 GCTGTGACTTCACCTCTCTAGGG - Intronic
1178758017 21:35371365-35371387 ACTGAGACGCCATCTCTGACAGG - Intronic
950678110 3:14566784-14566806 CATGTGACTGCATCTCTCACTGG - Intergenic
953129427 3:40124141-40124163 ACTTAGACTTCACCTCTCAGAGG + Intronic
953805517 3:46064477-46064499 AATTGGACTTCATCTCTCAGTGG - Intergenic
954608630 3:51932657-51932679 CCTGTGGCTTCGTCTCTCAGGGG + Intergenic
958198572 3:90277461-90277483 TGTGTGGCTTCATCTCACACAGG - Intergenic
959033890 3:101337158-101337180 TCTGTGAGTCCACCTCTCACAGG - Intronic
959494328 3:107031637-107031659 ACTCTCTCTTCTTCTCTCACAGG - Intergenic
959667749 3:108940728-108940750 ACTCTGACCTCAGCCCTCACAGG - Intronic
960995621 3:123338359-123338381 AATGTGACTTTGTCTCTGACAGG - Intronic
964771784 3:160231658-160231680 GCTGTGCTTTCATCTCTCTCTGG + Intronic
967033182 3:185627331-185627353 CCTGTGGCTTCAGTTCTCACAGG - Intronic
970268046 4:14311649-14311671 AGTATGTCTTCATCTCACACAGG - Intergenic
970971075 4:21984843-21984865 GCTGTGGCTTCCTCTCTCACAGG - Intergenic
973227952 4:47807677-47807699 ACTTTGACATCCTCTCACACAGG - Intronic
973628161 4:52793190-52793212 TCTGTGAGTGCATCTGTCACAGG - Intergenic
974242010 4:59261301-59261323 ACTATGACTACATCCCTCAGTGG - Intergenic
975588525 4:75976794-75976816 ACTGTGAATGCATATATCACTGG + Intronic
976605318 4:86977157-86977179 TCTGTGACTTCAGGACTCACTGG - Intronic
976703948 4:88002349-88002371 ACTCAGACTTCATCTCTCCCTGG - Intergenic
979338168 4:119487850-119487872 TCTCTAATTTCATCTCTCACTGG + Intergenic
979925123 4:126553233-126553255 AATCTCACTTCATCACTCACTGG - Intergenic
980116378 4:128683409-128683431 AGTGTGTCTTCACCTCACACTGG + Intergenic
980486970 4:133471028-133471050 AGTTTGAGTTCATCTGTCACTGG + Intergenic
982111259 4:152057443-152057465 ACTTTGAATTCATTTCTAACAGG + Intergenic
983095361 4:163554935-163554957 ACCTTGTCTTGATCTCTCACTGG + Intronic
987957465 5:24759335-24759357 ACTGTGAATCCATCTGGCACTGG + Intergenic
989239629 5:39188982-39189004 ATTGTGCCTTCATCTTTCAAAGG - Intronic
989280550 5:39637757-39637779 TCTGTTACTTCATCTATCAGAGG + Intergenic
989953393 5:50328407-50328429 ACTCTTCCTTCATCTCTCAGAGG + Intergenic
990145902 5:52759886-52759908 ATTCTGACTTCCTCTCACACAGG + Intergenic
990646523 5:57850611-57850633 ACTGTGACTCCATTTCCCCCAGG - Intergenic
992935325 5:81697184-81697206 AATGTTACATCATCTTTCACTGG + Intronic
997015060 5:129923087-129923109 ACTTAAAATTCATCTCTCACTGG - Intronic
998541344 5:142984534-142984556 TCTGTGCATTCATCTCTCAGTGG + Intronic
999888606 5:155951938-155951960 TCTGTGACTTGATCTTTGACTGG + Intronic
1001058665 5:168470010-168470032 ACTGTGAAGTCATCTCTCTCTGG - Intronic
1003913057 6:10760156-10760178 CCTATGACTTAATCTCCCACCGG + Intronic
1004910907 6:20282574-20282596 GCTGTGAATTCATCTCGTACAGG - Intergenic
1007172433 6:39873216-39873238 ACTGTGCCCTCTTCTCTCCCAGG + Exonic
1010883722 6:81211681-81211703 ACTGTGTTTTCTTCTTTCACAGG - Intergenic
1011985570 6:93439784-93439806 ACACTGACTCCATCTCTCAATGG - Intergenic
1013124649 6:107171064-107171086 CCTGTGACTACCTCTCTAACAGG - Intronic
1014436390 6:121425307-121425329 ACTCTGACTTCACCTCTGAGAGG + Intergenic
1017171874 6:151463834-151463856 AATATGATTTAATCTCTCACTGG + Intronic
1019853196 7:3579791-3579813 ACTTTGACTTCCTCTCTCTTTGG - Intronic
1020159398 7:5757066-5757088 ATTGTGATTTCTTCTCACACTGG + Intronic
1020455765 7:8372241-8372263 TTTCTGACTTCATCTCTCAGGGG - Intergenic
1023706065 7:42942892-42942914 AATCTGCCTTCACCTCTCACAGG - Intronic
1023850500 7:44147458-44147480 ACTAACCCTTCATCTCTCACAGG + Intronic
1025572753 7:62597685-62597707 TCTGTGCATTCATCTCACACAGG - Intergenic
1025739934 7:64186360-64186382 ACTGTGAGTTCATCCCCCTCAGG + Intronic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1026567594 7:71502316-71502338 AATGTGACCCCATCTCTCAGTGG - Intronic
1027509808 7:79066257-79066279 ACTGAGATATCATCTCACACTGG - Intronic
1028028516 7:85877917-85877939 ACTGTGAATTCATCTGGCCCTGG - Intergenic
1028451962 7:90995183-90995205 ACTTTGTCTTCCTCTCTTACCGG + Intronic
1028679580 7:93510338-93510360 ACACTGAGTTCATCTTTCACTGG + Intronic
1031877571 7:127159139-127159161 GCTTTGATTTCATCTCTCCCGGG + Intronic
1033884564 7:145929186-145929208 ACTGAGACTTCATCAACCACAGG - Intergenic
1036661745 8:10713777-10713799 ACTGTCACCCCATCACTCACTGG - Intergenic
1038231417 8:25704095-25704117 ACGGGGACTACATCTTTCACTGG + Intergenic
1038933175 8:32217983-32218005 ACTCTGACTTCAACACTCACAGG - Intronic
1040831489 8:51681817-51681839 ACTGGGACTCCACCTCTCAGTGG + Intronic
1041595604 8:59647410-59647432 ACTGTGACTTTATCTGTCATTGG + Intergenic
1041708896 8:60875458-60875480 CCTGTGACTTCCTCTCTGAGAGG + Intergenic
1042079508 8:65035836-65035858 ACTGTGACTTACCATCTCACTGG + Intergenic
1045429399 8:102098890-102098912 ACACTGACTTCATCTCTCACTGG + Intronic
1046390060 8:113559233-113559255 AAGATGACTTCATCTCTCACAGG + Intergenic
1048710298 8:137202539-137202561 ACTGTGACCTCTTCTCTCCGGGG + Intergenic
1048897110 8:139001887-139001909 CCTGTGCATTCATCTGTCACAGG + Intergenic
1049530654 8:143153216-143153238 TATGTGACTTCATCTCTGCCGGG + Intergenic
1052618985 9:30880756-30880778 ACTGTGACTCCATCTGGTACTGG + Intergenic
1057319403 9:93998561-93998583 ACTGATACTTCAACTATCACAGG + Intergenic
1057994541 9:99808956-99808978 ACTTTTCCTTCATCTCTCATTGG + Intergenic
1058467060 9:105239553-105239575 ACTGTGACCTTCTCTCACACTGG + Intergenic
1059709982 9:116858724-116858746 ACTGTTACTTCCTCTATCACTGG + Intronic
1060206822 9:121687091-121687113 CCTGGGACTTCAACACTCACTGG - Intronic
1061754234 9:132801803-132801825 ACTGTGACTACTTCTTTCATAGG - Intronic
1186204657 X:7188644-7188666 TCTTTGTCTTCATTTCTCACTGG + Intergenic
1189109396 X:38271743-38271765 ATTGTGAGTTCATGTTTCACTGG - Intronic
1189606463 X:42683437-42683459 AATGTGGATTCATCTCTCAGGGG + Intergenic
1189714922 X:43855520-43855542 ACTGCTTCTTCATCTGTCACTGG + Intronic
1190392547 X:49946544-49946566 ACTGAGACTTTATCCCTCGCTGG - Intronic
1193592037 X:83401200-83401222 AATGTGATATCATCTCACACTGG + Intergenic
1193781310 X:85705074-85705096 ACTGTGAAATTACCTCTCACTGG + Intergenic
1193811000 X:86050709-86050731 ACTGTCACTTCTTTTCTCTCAGG + Intergenic
1194175102 X:90636279-90636301 TCTGTGAATTCATCTTTTACTGG - Intergenic
1195720211 X:107860123-107860145 GCTGGGCCTTCATCTCTCCCTGG - Intronic
1196724947 X:118887382-118887404 ACTGTCACTTCTTCTCCCTCGGG - Intergenic
1197081486 X:122423352-122423374 ACTGTGAATTCATCTGGTACTGG + Intergenic
1200521748 Y:4217252-4217274 TCTGTGAATTCATCTGTTACTGG - Intergenic
1201577324 Y:15475056-15475078 TCTTTGTCTTCATTTCTCACTGG + Intergenic
1202088565 Y:21164325-21164347 ACTTTTACTTCATCTGTCTCTGG + Intergenic