ID: 947683503

View in Genome Browser
Species Human (GRCh38)
Location 2:232058825-232058847
Sequence CTTTCTTACATCACTGAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947683503_947683504 6 Left 947683503 2:232058825-232058847 CCTGACTCAGTGATGTAAGAAAG 0: 1
1: 0
2: 0
3: 25
4: 183
Right 947683504 2:232058854-232058876 AGAATTAAATGTAACAATTATGG 0: 1
1: 0
2: 1
3: 66
4: 612
947683503_947683505 10 Left 947683503 2:232058825-232058847 CCTGACTCAGTGATGTAAGAAAG 0: 1
1: 0
2: 0
3: 25
4: 183
Right 947683505 2:232058858-232058880 TTAAATGTAACAATTATGGCAGG 0: 1
1: 0
2: 4
3: 35
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947683503 Original CRISPR CTTTCTTACATCACTGAGTC AGG (reversed) Intronic
901245614 1:7728235-7728257 TTCCCTGACATCACTGAGTCAGG - Intronic
901381005 1:8874231-8874253 CTTCCTTACTTCACTGACTTAGG + Intronic
902084098 1:13844362-13844384 CTTTCATCCATCACTAGGTCAGG - Intergenic
903784015 1:25844905-25844927 CTGTCATGCCTCACTGAGTCAGG + Intronic
905420339 1:37838660-37838682 CTTCCTCAGATCACTGAGTGTGG + Exonic
907526687 1:55057861-55057883 CTGTCTTACCTCACTGAGTAAGG + Intronic
908081764 1:60588334-60588356 CTTTGTTACATGACAGATTCTGG - Intergenic
908149202 1:61282310-61282332 CTTTGTTATATCACTGAATCTGG + Intronic
909341906 1:74541733-74541755 TTTTCTTTCATCCCTGAGACAGG - Intronic
909650325 1:77968349-77968371 CTTTTTTAGATTACTGAGTTGGG - Intronic
910320143 1:85934144-85934166 CTTTCTTGCATCACTTAATCTGG - Intronic
911119152 1:94277760-94277782 CTTCCTCCCATCACTGTGTCAGG - Intergenic
912096784 1:106154545-106154567 CTTGCTTAAAACAGTGAGTCTGG - Intergenic
916437350 1:164789478-164789500 CTTTCATACCTCACTGAGTTTGG + Intronic
917455341 1:175181326-175181348 TTTTCTTCCTTCACTGATTCTGG + Intronic
918982250 1:191578143-191578165 CCTTCTTACAACTCTGAGTTTGG + Intergenic
920278761 1:204828173-204828195 CTCTCTCACATCCCTGAATCAGG + Intergenic
920604209 1:207364269-207364291 CCTTCTTAAATCACTAATTCAGG + Intergenic
920743329 1:208601878-208601900 ATTACTTACACCACTAAGTCCGG - Intergenic
920772364 1:208901227-208901249 CCTTTTTACATCTCTGAATCAGG - Intergenic
922357051 1:224786311-224786333 CTTTCCTATCTCACAGAGTCAGG - Intergenic
924259704 1:242216748-242216770 CTCTCATCCATCACTGAGTTAGG + Intronic
924646635 1:245883894-245883916 CTTTTTTACATCACCCACTCTGG - Intronic
924849274 1:247808522-247808544 TTCTCTTACATCACTCAGTCTGG + Intergenic
1065728070 10:28685363-28685385 ACTTCTGACATCACTGAATCAGG - Intergenic
1065991045 10:31010779-31010801 CTTTCTTGCATGACTGAGGCAGG + Intronic
1067037285 10:42930054-42930076 CTTCCTTACATCAATCTGTCAGG + Intergenic
1071391129 10:85176321-85176343 CTTTCATACAACACTGATTCTGG - Intergenic
1077409597 11:2397355-2397377 CTTTATTAAATGACGGAGTCAGG - Exonic
1079574692 11:21988943-21988965 CTTCCCTACATCACTTAGTCAGG + Intergenic
1079574700 11:21989012-21989034 CTTCCCTACATCACTTAGTCAGG + Intergenic
1080941637 11:36925010-36925032 CCTTCTTCCACCACTGGGTCTGG + Intergenic
1081229552 11:40568183-40568205 CTTTCTCAGATCTCTGACTCTGG + Intronic
1081610401 11:44559353-44559375 CTTTCTGAAATGACTGAGACAGG + Intergenic
1087101184 11:94366673-94366695 CTTTCTTACATTGCAGAGGCTGG + Intergenic
1091209110 11:133841784-133841806 CTCTCTGACACCACAGAGTCAGG + Intronic
1095486933 12:42695142-42695164 CTTCCTCACAGCACTGAGGCTGG - Intergenic
1096402851 12:51321707-51321729 CTTTCTTATATCCCTGTCTCTGG + Intronic
1096763842 12:53866872-53866894 CGTTCTGATATCACTGAGTCTGG - Intergenic
1099510305 12:83527382-83527404 CTTTCTGACATCACTGATACAGG + Intergenic
1099886116 12:88533222-88533244 CTTACTTACATCAGTCATTCTGG + Intronic
1103184025 12:118940609-118940631 CTCTCTTGGATCACTTAGTCTGG - Intergenic
1104190047 12:126472343-126472365 TTTTATTACATCACTAAGTTTGG - Intergenic
1104287438 12:127437256-127437278 CTGTCTTAGATCACTCACTCTGG + Intergenic
1108451807 13:50574775-50574797 CTTTCCTACATCTCAGGGTCAGG - Intronic
1108833727 13:54513706-54513728 CTTTGGTAAAACACTGAGTCAGG - Intergenic
1109110528 13:58313408-58313430 TTTTCTTGCATCACTTACTCTGG - Intergenic
1110198047 13:72813492-72813514 TTTTCTTACCTCACTGAGGCTGG + Intronic
1111407968 13:87834782-87834804 CTTCATTTCATCACAGAGTCAGG + Intergenic
1112780379 13:102894163-102894185 CTTTCTTAAATCTCAGAGTAAGG - Intergenic
1115692450 14:35858841-35858863 CTATCTTGGATCACTAAGTCTGG - Intronic
1116656233 14:47656994-47657016 CTTTCTTACAGCACGGTGTGAGG - Intronic
1116804756 14:49482233-49482255 CTTCCTCACATGGCTGAGTCTGG - Intergenic
1117564362 14:56978156-56978178 CTGTATTACATGAATGAGTCTGG - Intergenic
1119461395 14:74807334-74807356 ATTTCTTAGTTCACTGTGTCTGG - Intronic
1120423180 14:84314309-84314331 CTTTCTGACAGCCCTCAGTCTGG + Intergenic
1121300415 14:92866259-92866281 TTGTTTTACATCACTGAGTTTGG - Intergenic
1121778325 14:96605716-96605738 CTTGCTGACATGTCTGAGTCTGG + Intergenic
1124354877 15:28987525-28987547 CTCTCTTGAATCACTGAGGCTGG - Intronic
1124838087 15:33215172-33215194 CTTTCCTTCATTACTAAGTCTGG + Intergenic
1125337015 15:38636708-38636730 CTGTCTTGGATCACTCAGTCTGG + Intergenic
1126140895 15:45437761-45437783 CTTTCTTAAAACATTGAGTTTGG - Intronic
1128698827 15:69789184-69789206 ATTTCTTACATCTCTGAATAAGG + Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1131706124 15:94998542-94998564 ATTTCTTACATCATCGACTCTGG + Intergenic
1135461033 16:22643126-22643148 CTTTCTTACAGTTCTGAGTCTGG + Intergenic
1139173276 16:64657339-64657361 TATTCTGACATCACTGAGGCAGG + Intergenic
1141559926 16:84860948-84860970 TTTTCTTTCATCACTTTGTCCGG + Intronic
1141823090 16:86461149-86461171 CTGTTTTACATCACTAAGTTTGG - Intergenic
1143298440 17:5889227-5889249 CTGTCTTAGATCACTCAGTCTGG - Intronic
1143341154 17:6212211-6212233 CTTTCTTTCTTGACTCAGTCTGG + Intergenic
1144052936 17:11513337-11513359 ATTTCTTTGATCACTGAGGCTGG + Intronic
1146614102 17:34337941-34337963 CTATCTCACATCACTGAGAATGG - Intergenic
1148251831 17:46088270-46088292 CTTCCTTACATCACTCTATCAGG + Intronic
1148368418 17:47073994-47074016 CTTCCTTACATCACTCTATCAGG + Intergenic
1149909412 17:60553292-60553314 CTTTCTTGAATCACTCACTCTGG + Intergenic
1155533519 18:26791930-26791952 CTTTCTTGCATCTCTCACTCTGG - Intergenic
1155909504 18:31492251-31492273 CTTTTTTACATCATTGAATCTGG - Intergenic
1156197135 18:34787420-34787442 CTTTCTTGAATCCCTGAGGCTGG - Intronic
1156765448 18:40648747-40648769 CTTTCCTAAATCACTGATTCTGG + Intergenic
1157865712 18:51182562-51182584 CTTTCCTACATCACTGTTGCTGG + Intronic
1159252567 18:65899092-65899114 CTTTCTTTCATTACTAATTCTGG - Intergenic
1160779486 19:871524-871546 CATTCTTACATCCCAGTGTCTGG - Intronic
1161826252 19:6567964-6567986 CTTTCATCCATCACTGGGTCAGG - Intergenic
1161860526 19:6794761-6794783 TTTTCTTACATCACTCAGTTTGG - Intronic
1162271272 19:9617824-9617846 CTTTCTTACATTGCTGGGTGCGG - Intronic
1162276419 19:9659112-9659134 CTTTCTTACATTGCTGGGTGCGG - Intronic
1162848668 19:13413867-13413889 CTTTCTTTCTTGACAGAGTCTGG - Intronic
1164011833 19:21210433-21210455 CTTTCATCCATCACTGTGTCAGG + Intergenic
1164831706 19:31327026-31327048 CTTCCTTACAGCACTCAGCCAGG + Intronic
1167561201 19:50227011-50227033 CTTTCAGACAGCACTGAGTATGG + Intronic
1168092331 19:54094340-54094362 CTTCCTTTCGGCACTGAGTCTGG + Intergenic
926260211 2:11253158-11253180 CTTTCTTCCATCGCTGAATAGGG - Intronic
929032433 2:37661734-37661756 CTCTCATACATCACTAATTCTGG - Intronic
929343598 2:40853519-40853541 CTCTCTTCCATCACTGTGACAGG + Intergenic
929804216 2:45130456-45130478 CTTTCTCACAACACTGTGGCTGG + Intergenic
933917294 2:87008608-87008630 ATTTCTTTCATATCTGAGTCTGG - Intronic
934005702 2:87761306-87761328 ATTTCTTTCATATCTGAGTCTGG + Intronic
935227114 2:101062144-101062166 CTCTATCACATCACTAAGTCGGG + Intronic
935768657 2:106395406-106395428 ATTTCTTTCATATCTGAGTCTGG + Intronic
935911444 2:107900522-107900544 ATTTCTTTCATATCTGAGTCTGG - Intergenic
935969561 2:108517362-108517384 ATTTCTTTCATATCTGAGTCTGG - Intergenic
936133226 2:109865580-109865602 ATTTCTTTCATATCTGAGTCTGG - Intergenic
936211471 2:110505905-110505927 ATTTCTTTCATATCTGAGTCTGG + Intergenic
936420609 2:112360480-112360502 ATTTCTTTCATATCTGAGTCTGG + Intergenic
940494354 2:154406412-154406434 ATTCCTTACATTACTTAGTCTGG + Intronic
941323922 2:164089144-164089166 CACTCTTACATAAATGAGTCAGG + Intergenic
942559952 2:177209843-177209865 CTTTCTCATATCAAAGAGTCAGG + Intergenic
942627868 2:177922595-177922617 ATACCTGACATCACTGAGTCCGG + Intronic
943009456 2:182429556-182429578 ATTTCTAACAGCACTGAGTCGGG - Intronic
945262986 2:207862074-207862096 CTTGCATACATCCCTGAGTTTGG + Intronic
946853814 2:223933518-223933540 CTTTCTTACATTACAAAGTCTGG + Intronic
947683503 2:232058825-232058847 CTTTCTTACATCACTGAGTCAGG - Intronic
1168935146 20:1658513-1658535 ATTTCATTCATCACTGAGTTCGG + Intergenic
1169806885 20:9568614-9568636 CTTTCTTACATCATTTATTTTGG + Intronic
1169850698 20:10047227-10047249 CTTTTCTGCATCACTGAGTTAGG - Intronic
1170700717 20:18700937-18700959 CTTTTTCACCTCACAGAGTCAGG - Intronic
1171294516 20:24005739-24005761 CTTTCTTACAGCACGGTGTCTGG + Intergenic
1174435583 20:50504462-50504484 CTTGCTGACCTCACTAAGTCAGG + Intergenic
1178343315 21:31804507-31804529 CTTTCTTTCAAGACAGAGTCTGG + Intergenic
1178522968 21:33301873-33301895 CTATCTTAGATGATTGAGTCTGG - Intergenic
1179783412 21:43716891-43716913 CTGTCCTACCTCACTGAGCCTGG - Intergenic
1182015322 22:27034303-27034325 CTTTCTCAAATGACTAAGTCAGG + Intergenic
1184549116 22:45195087-45195109 CTTTCACACATCACTGTGACTGG + Intronic
950411359 3:12840065-12840087 GTTTCTGACATCACCTAGTCAGG - Intronic
951673941 3:25215833-25215855 CTTTCTTGAATCACAGAGTGTGG - Intronic
953597289 3:44329468-44329490 CTTTCTTGGATCACTCATTCTGG - Intronic
954378361 3:50206364-50206386 CTTTCTTCCATGACCGACTCTGG + Intronic
955018633 3:55096819-55096841 CTTTTTTATTTCTCTGAGTCCGG + Intergenic
955235187 3:57132818-57132840 TTTTTTTTCATCACTGAGTGTGG + Intronic
956149653 3:66227141-66227163 CTTGCTGACATAACTTAGTCTGG + Intronic
956398962 3:68856104-68856126 TTTCCTTACACCACGGAGTCTGG - Intronic
956714643 3:72067903-72067925 CTTTCTTAGGTCACTCATTCTGG + Intergenic
957973301 3:87410386-87410408 CTTTTTTAAACCACTGAGTTTGG + Intergenic
958538500 3:95435803-95435825 CTTTTTTACATCACGGAGGACGG - Intergenic
959502772 3:107125460-107125482 ATTTCTTACAACACTTAGTGAGG - Intergenic
962264945 3:133938198-133938220 TTTTCTTACATAACTTAGTTAGG + Intronic
963948614 3:151173275-151173297 CTTTCTTCCACCAATGAGTTGGG - Intronic
963989522 3:151637181-151637203 CTGTTTTGAATCACTGAGTCTGG - Intergenic
965665031 3:171084267-171084289 CTTTCTTGCTTCATTGAGTTTGG + Exonic
965955209 3:174361421-174361443 CTTTCTTACATCACTTCTTATGG + Intergenic
966357822 3:179100699-179100721 CTTTCTTAAATCACTCATTTTGG + Intergenic
968681953 4:1927201-1927223 CTTTCTTGGATCACTTACTCTGG - Intronic
968872655 4:3249609-3249631 CTTTCTTGGAGCTCTGAGTCGGG + Intronic
970609320 4:17710588-17710610 TAGTCTTACATCACTGAGTATGG - Intronic
974903043 4:68024257-68024279 CTTTCTTATATGCCTGACTCAGG - Intergenic
975008795 4:69323070-69323092 CATTCTTATATCGCTGAGTCTGG - Intronic
975938464 4:79611228-79611250 CTGTCATAAATCACTGAGTCAGG + Intergenic
980520272 4:133922740-133922762 TTTTCATACATCACAGACTCAGG + Intergenic
981534580 4:145785944-145785966 CTTTCTAACATCTCTGTGCCTGG - Intronic
982064875 4:151645360-151645382 CTTTCTTTCCTCTCTGACTCTGG + Intronic
983004127 4:162461655-162461677 CTTTCTTTCATCCCTCACTCTGG + Intergenic
983288584 4:165771200-165771222 CATTCTTAGATAACTTAGTCTGG - Intergenic
983881115 4:172934330-172934352 TTTTCTTAGTTCACTGAGGCTGG - Intronic
985905900 5:2836289-2836311 CTGTCTTTCATCACTAAGTATGG - Intergenic
986213718 5:5698611-5698633 CATCCTTGCATCCCTGAGTCTGG - Intergenic
986618112 5:9640806-9640828 CTCCCTTACATAATTGAGTCTGG - Intronic
986834046 5:11614740-11614762 CTGTGTTTCATCACTGAGTGGGG + Intronic
986880409 5:12162993-12163015 CTCTCATATATAACTGAGTCAGG + Intergenic
987798336 5:22659347-22659369 TTTTCATACAACACTGAGACAGG - Intronic
990842447 5:60098088-60098110 CAATCTTAAATCACTGTGTCTGG - Intronic
991401515 5:66256649-66256671 GTTTCTTAAATTTCTGAGTCTGG - Intergenic
992030690 5:72718555-72718577 CTTTATTATATCACTTAGACTGG + Intergenic
993959766 5:94282727-94282749 ATTTCTTACATTACAGAGGCAGG - Intronic
994041965 5:95268875-95268897 CTTTCATCCATCGCTGGGTCAGG + Intronic
995206056 5:109482729-109482751 CTTTCATCCGTCACTGGGTCAGG - Intergenic
995575737 5:113531230-113531252 CTCTCATCCATCACTGGGTCAGG - Intronic
996738250 5:126776868-126776890 CTTCCTTACAGCCCTGAGCCTGG + Intronic
996855250 5:127998679-127998701 CTCTGTTTCATCACTGACTCTGG + Intergenic
998421982 5:141995960-141995982 ATTTCTGACATATCTGAGTCTGG - Intronic
998505457 5:142668518-142668540 CTTTATTACCTAACTGTGTCTGG - Intronic
1002553231 5:180013862-180013884 CTTTCTAATCTCACTGAGACAGG + Intronic
1010426693 6:75735597-75735619 CTATCTTAGATCAATGAGGCAGG - Intergenic
1011359064 6:86502361-86502383 CTTTCATCCATCACTCAGCCAGG - Intergenic
1011989335 6:93493470-93493492 ATTTCTTACAGCACTCATTCTGG - Intergenic
1013292701 6:108732671-108732693 CTTTCTTCCCTCAATGACTCAGG - Intergenic
1016068121 6:139704997-139705019 CTTTCTTAGATTACTCAGTCTGG + Intergenic
1016077831 6:139818660-139818682 CTTCTTTACAACACTGAGTTTGG - Intergenic
1017502608 6:155039383-155039405 ATTTCTTACATCTCAGACTCAGG - Intronic
1017657236 6:156641712-156641734 CTCTCTTGCAACACTCAGTCTGG - Intergenic
1017713780 6:157193071-157193093 CTTCCTTACTTCACTGATTGAGG + Intronic
1017858793 6:158376178-158376200 CTTTTTTAAGTAACTGAGTCTGG - Intronic
1018067876 6:160136352-160136374 GTATCTCACATCACTGAATCTGG + Intronic
1018485016 6:164232335-164232357 CATTCCTGCAACACTGAGTCAGG + Intergenic
1024538104 7:50454999-50455021 CATTCTTACAGCACTGCGGCAGG + Intronic
1028727354 7:94102389-94102411 CTTTAGTACATGACTGTGTCCGG - Intergenic
1030021403 7:105278672-105278694 CTTTCCTTCTTCACGGAGTCTGG - Intronic
1031707541 7:124999576-124999598 CTTTCATTCATCTCTGGGTCAGG + Intergenic
1032287827 7:130555967-130555989 CTGTCTTTCATCGCTGAGCCAGG - Intronic
1032298502 7:130665237-130665259 CTTTATTAAATCTCTGAGTGAGG + Intronic
1032914934 7:136479146-136479168 ATTTAATACATCACAGAGTCTGG + Intergenic
1034745923 7:153523996-153524018 CTTTCTTACATACCTGTGACTGG + Intergenic
1046127633 8:109929930-109929952 CTCTCTTAAATCACTCACTCTGG - Intergenic
1047325337 8:123830416-123830438 TTTTCTTTCATCACTGGGTTTGG + Intergenic
1048449905 8:134524067-134524089 CTGTCTTGCGTCACTGACTCTGG + Intronic
1050072581 9:1831841-1831863 CTGTGTCACATTACTGAGTCTGG - Intergenic
1051801640 9:20940844-20940866 CTTTCTTACATAACACAGTATGG + Intronic
1052633987 9:31076736-31076758 CTTTATTATATCATTGAGACTGG - Intergenic
1059765264 9:117378223-117378245 CTGTCTAACATCACAGAGTGGGG + Intronic
1060196776 9:121629100-121629122 CTTGGGTCCATCACTGAGTCTGG - Intronic
1062164801 9:135102249-135102271 CTTTCTCACATCTCAGGGTCAGG - Intronic
1186617165 X:11201577-11201599 CTTTTATAAATCACCGAGTCCGG - Intronic
1191773444 X:64786404-64786426 CTTTCATCCATCACTCAGCCAGG - Intergenic
1198335066 X:135657798-135657820 TTTTTTTACATCAATCAGTCTGG + Intergenic
1199937587 X:152590629-152590651 ATTTCTTACAGCACTGATTTGGG - Intergenic
1200875689 Y:8152297-8152319 CTTTCTGATATCCCTGAGTAGGG - Intergenic
1200976389 Y:9216052-9216074 TATTCATCCATCACTGAGTCAGG - Intergenic
1201620422 Y:15951022-15951044 TATTCATTCATCACTGAGTCAGG - Intergenic
1202025587 Y:20519461-20519483 CTTTCCTCCATCACTGTCTCAGG + Intergenic