ID: 947684612

View in Genome Browser
Species Human (GRCh38)
Location 2:232071871-232071893
Sequence TGGGAATGTTTTTGAATAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947684606_947684612 16 Left 947684606 2:232071832-232071854 CCTGGCTGATAAGTAGTTTCTCT 0: 1
1: 0
2: 1
3: 9
4: 169
Right 947684612 2:232071871-232071893 TGGGAATGTTTTTGAATAAGAGG 0: 1
1: 0
2: 3
3: 17
4: 313
947684605_947684612 24 Left 947684605 2:232071824-232071846 CCACTGTACCTGGCTGATAAGTA 0: 1
1: 0
2: 14
3: 140
4: 990
Right 947684612 2:232071871-232071893 TGGGAATGTTTTTGAATAAGAGG 0: 1
1: 0
2: 3
3: 17
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947684612 Original CRISPR TGGGAATGTTTTTGAATAAG AGG Intronic
900560808 1:3305176-3305198 TGGAAATGTTCTTGAACAAAAGG - Intronic
901086991 1:6616716-6616738 AGGGAATGTGTTTGAAGGAGAGG - Intronic
901729645 1:11270200-11270222 TGTTAATGATTTTGAACAAGAGG + Intergenic
903607986 1:24588951-24588973 TGGGAGGGTTTTTGAAGAAGGGG + Intronic
906163548 1:43669034-43669056 TATGAATGTGTTTGAGTAAGTGG + Intronic
906989223 1:50720283-50720305 GGTAAATGTTTTTTAATAAGGGG - Intronic
908247931 1:62242733-62242755 TGGGAATGTCTTTGGAAAACTGG - Intronic
911144644 1:94541254-94541276 TTGGACTGTTGTTGCATAAGCGG - Intronic
911412981 1:97534050-97534072 TGGAAATGTTTTAGATTATGAGG - Intronic
911557723 1:99365459-99365481 TCAGAGTGTTTTTCAATAAGAGG + Intergenic
912983009 1:114395669-114395691 TAAAAATGTTTTTTAATAAGAGG - Exonic
913712372 1:121498093-121498115 TGTGAATGGTTTAGAATAATTGG - Intergenic
915621334 1:157087037-157087059 AGTTAATTTTTTTGAATAAGTGG - Intergenic
917039239 1:170785194-170785216 TGGGACTGTTCTTAATTAAGAGG + Intergenic
917089744 1:171341268-171341290 TGGGAATGTTTTTGTATGTTAGG - Intronic
917294101 1:173501437-173501459 TGGGAATCTTTTTAAGTAATGGG + Intronic
917683790 1:177395205-177395227 TGGGATAGGTGTTGAATAAGAGG + Intergenic
918656714 1:187035829-187035851 TGGGACTGTATTTGAATATAGGG - Intergenic
918913373 1:190603145-190603167 TGGGGCTGTTGCTGAATAAGTGG + Intergenic
920071231 1:203304755-203304777 TGCTAATTTTTTTGAATTAGTGG - Intergenic
920165482 1:204032719-204032741 TAGGAATGTTTTTCAATGATAGG - Intergenic
923435748 1:233966245-233966267 TAGGAAAGATTTTCAATAAGAGG + Intronic
923449890 1:234106655-234106677 TGTGAATGTGTTTGAAGAAAGGG - Intronic
923591105 1:235320404-235320426 TGGGAATATATTTGAAGATGGGG - Intronic
924191051 1:241552984-241553006 TGAGAATGTTTTCTACTAAGGGG - Intronic
924898265 1:248366456-248366478 TGGAAATGTTTTGGAACTAGAGG + Intergenic
1062776136 10:149672-149694 TGGGTATGTTTTAGTATAAATGG + Intronic
1063724059 10:8617100-8617122 TAGGAATTTTTTTAAATATGTGG + Intergenic
1064330676 10:14391337-14391359 TGAGAAGGTTCTTGAAGAAGTGG - Intronic
1064879409 10:20033350-20033372 TGGAAATATTTTTACATAAGGGG + Intronic
1066039156 10:31528053-31528075 TGTGATTGTGTTTGAATATGTGG + Exonic
1068343941 10:55746872-55746894 TGGGAATGTTTATGATTAATTGG - Intergenic
1068722474 10:60261459-60261481 TGGGAATGTTCTGGAATACCTGG - Intronic
1068836463 10:61559828-61559850 TTGTAATTTTTTTGAAGAAGGGG - Intergenic
1069400734 10:68042794-68042816 TGGAAATGTTTTTTTATAAAAGG - Intronic
1070490199 10:76968897-76968919 TGCAAATGTTATTGAATATGGGG + Intronic
1071953020 10:90726807-90726829 TAGGAATTTTTTTTAATAATTGG - Intergenic
1073269296 10:102248562-102248584 TGGGAATGTATTAGGATTAGTGG + Intronic
1073902386 10:108238102-108238124 TGGTAATGCTGTTGAATATGAGG - Intergenic
1074259453 10:111837208-111837230 TGGAAATGTCTTTGTAGAAGTGG - Intergenic
1074740017 10:116477416-116477438 TTGGAATTTTCCTGAATAAGAGG + Exonic
1075964878 10:126602861-126602883 TTGGAATGTATTTCAACAAGAGG - Intronic
1077255270 11:1578963-1578985 TGGGAATGTATAGGAATAATTGG - Intergenic
1078922172 11:15841114-15841136 AGGGAATGCATTAGAATAAGGGG + Intergenic
1079432074 11:20401162-20401184 TTGGAATTCTTTTGATTAAGGGG + Intronic
1080173649 11:29336544-29336566 TAGGAATATTTTTCAATAAGGGG - Intergenic
1081025315 11:38005425-38005447 TGGGAAAGTTTGTGGAAAAGTGG + Intergenic
1081983683 11:47286325-47286347 TGGGATTGTGTTTGAAAAGGAGG + Intronic
1082767006 11:57177783-57177805 TGACAATGTTCTTGAATTAGGGG + Intergenic
1083556194 11:63630483-63630505 TTGGAATGTTTTTGCATTAAAGG + Intronic
1083784228 11:64934635-64934657 ATGGAATTTTTTTAAATAAGGGG - Exonic
1084326915 11:68405839-68405861 TGGGAATGTCTGTGAATCGGAGG + Intronic
1085408950 11:76280457-76280479 TCGGAATATTTTTTAACAAGTGG - Intergenic
1086198838 11:84175452-84175474 TGGTAAGATTTTTGAATAAAAGG - Intronic
1087560896 11:99788846-99788868 GGGGAATGCTTTTTATTAAGGGG + Intronic
1090766077 11:129877445-129877467 TGGGAATGGTTCTGAAGCAGGGG - Intronic
1092281181 12:7098827-7098849 TGGAAATGTTCTGGAATTAGTGG + Intronic
1092510048 12:9144918-9144940 TGGGGCAGTTTTTGATTAAGGGG + Intergenic
1093405231 12:18796916-18796938 TGGATATGTATTTAAATAAGGGG + Intergenic
1094087661 12:26611232-26611254 TGGGACTGTTTTTGCAGATGAGG - Intronic
1094670566 12:32564207-32564229 TGAGAATGTATCTGAAGAAGAGG + Exonic
1094749414 12:33388159-33388181 TTGGAATCTTTTTGTATTAGGGG + Intronic
1095511677 12:42957691-42957713 TGGGAATGTTCTAGATTCAGAGG + Intergenic
1095516414 12:43011232-43011254 TGTGAATGTTATGGAGTAAGAGG + Intergenic
1095566633 12:43631957-43631979 TGGGAAAGATTTTGAAGATGGGG - Intergenic
1096891529 12:54776532-54776554 TGGGAAAGTTTTTAAAAAATTGG + Intergenic
1097636167 12:62124962-62124984 TGGTACTTTTTTTGAACAAGGGG - Intronic
1098090612 12:66896852-66896874 TGGGAATGTTTTTGAAATCTTGG - Intergenic
1098657038 12:73045314-73045336 TGAGAAGGTTTTAGAAGAAGAGG + Intergenic
1098777263 12:74636138-74636160 TTGGAACATTTTTGAATAACAGG - Intergenic
1098822984 12:75256241-75256263 TGGAAATGTTCTGGAATTAGTGG + Intergenic
1100081999 12:90863858-90863880 TTGGGATATTTTTGAATAAATGG - Intergenic
1100287128 12:93177585-93177607 TGTGACTGTCTTTGAATATGGGG - Intergenic
1100502606 12:95188539-95188561 ATGGAAAGTTTTAGAATAAGTGG - Intronic
1101252249 12:102948017-102948039 TGGGAATCTTTCTGGATGAGGGG - Intronic
1101618712 12:106362704-106362726 TGTGACTGTTTTTGAAGATGGGG - Intronic
1103517403 12:121516260-121516282 TGGGAATCTTTCTAAATTAGGGG + Intronic
1103758190 12:123227298-123227320 TGGGAATGATATTGAATGAATGG - Intronic
1103864304 12:124039556-124039578 TGGAAATGTTTTTCAAAGAGAGG - Intronic
1105774948 13:23650255-23650277 GTGGAATGTTTTTAAATATGTGG + Intronic
1105782001 13:23714062-23714084 GGGAAATGTTTTTGAATAGATGG - Intergenic
1105803996 13:23938998-23939020 GGGAAATGTTTTTGAATAGATGG - Intergenic
1106028023 13:25973713-25973735 TGGGACTGATTTTGACTTAGAGG - Intronic
1106078188 13:26478813-26478835 TGGGAATGTATTAAAATGAGTGG - Intergenic
1106239895 13:27903139-27903161 AGAGAATGTTTTTTAAAAAGTGG + Intergenic
1106769575 13:32948859-32948881 TGGTAATGATTTTGAATTATTGG + Intergenic
1108171156 13:47743537-47743559 TGGGAATATTTTTGAACTATGGG - Intergenic
1108410466 13:50141345-50141367 TGGGAATTTGTTTGAATATTTGG + Intronic
1108417720 13:50216846-50216868 TGGAAATGTTTGTGAAGAATTGG - Intronic
1110457566 13:75707317-75707339 TGGGAAAGTTTATGAAAAATTGG - Intronic
1111509033 13:89236322-89236344 TGGGAAAGTCTTGAAATAAGAGG - Intergenic
1112720653 13:102240855-102240877 TGATAATTTTTTTAAATAAGAGG - Intronic
1112781662 13:102907201-102907223 TGAAAATGTTTTGGAATTAGTGG + Intergenic
1113865716 13:113521744-113521766 TTGGAATGTATTTGTATATGCGG - Intronic
1116294413 14:43087962-43087984 TGGGAATGTATCTGGAAAAGAGG - Intergenic
1117001022 14:51371350-51371372 ATTGAATGTTTTTGAGTAAGAGG + Intergenic
1117255751 14:53975765-53975787 TGGGAAGCTTTATGAAAAAGAGG - Intergenic
1117789557 14:59325343-59325365 TGGGCATGTTTTTCCATAAAGGG + Intronic
1118242522 14:64073758-64073780 TGGAGAGGTTTTTGATTAAGTGG + Intronic
1118809623 14:69263411-69263433 GAGAAATGTTTCTGAATAAGCGG - Intronic
1119518390 14:75266545-75266567 TGGGAATGTCTTTAAAAGAGAGG - Intronic
1120347726 14:83311354-83311376 AAGGAATGTTTTTGATTCAGAGG + Intergenic
1121079473 14:91096070-91096092 TGGGAATGTTTTGAGATAGGTGG + Intronic
1122099512 14:99396150-99396172 TCTGAATGCTTTTGGATAAGAGG - Intergenic
1122342311 14:101036522-101036544 TGGGAATGTTTGTGACTACATGG + Intergenic
1122685787 14:103505472-103505494 TGGACATGTTTTGAAATAAGAGG + Intergenic
1123062745 14:105601671-105601693 AGGGAATGTTTTTGCAGCAGCGG + Intergenic
1125455180 15:39851192-39851214 TTTGAATGTTTTTAAAGAAGAGG - Intronic
1126463191 15:48935698-48935720 TGGGCAGGGTTTTGAAGAAGCGG + Intronic
1127575811 15:60290923-60290945 GGGGAAGGTTTTTTAAAAAGAGG + Intergenic
1127815905 15:62608676-62608698 TGAGTTTATTTTTGAATAAGAGG + Intronic
1130627897 15:85534744-85534766 TGTAAATATTTTTGAAAAAGTGG - Intronic
1130678758 15:85978015-85978037 TGGGAATGCTGGGGAATAAGTGG + Intergenic
1130864637 15:87922030-87922052 TGGGAATCTCATTTAATAAGTGG - Intronic
1132168496 15:99622154-99622176 TGGGAATGTTTTTAAAAATCTGG + Intronic
1132325309 15:100963992-100964014 TAGGAATTTTTGTTAATAAGAGG - Intronic
1133017809 16:2952674-2952696 TGGGAATGTTTATGAATACGGGG - Intergenic
1134050242 16:11132163-11132185 TGGAAATGTTTTGGAACTAGAGG - Intronic
1134781005 16:16895647-16895669 TGGGATTGTGTTAGACTAAGTGG - Intergenic
1134893812 16:17865756-17865778 TGGGTAAGTTTTTGGATAAATGG + Intergenic
1135142537 16:19933970-19933992 TGGGATTCTTTTTGAAGGAGAGG + Intergenic
1135570726 16:23547397-23547419 TGGAAATGTTCTGGAATTAGTGG + Intronic
1138468394 16:57211116-57211138 TAAGAATGTTTTTTATTAAGAGG + Intronic
1138762922 16:59565572-59565594 TTGTAATATTTTTGAATAATAGG - Intergenic
1138961037 16:62029656-62029678 AGGCAATGTTTTTTAATGAGCGG - Intronic
1139539153 16:67600991-67601013 TGGGTATGTTTTGTACTAAGAGG + Intronic
1141332881 16:83128012-83128034 TGGGAAGAGTTTTGAAGAAGTGG - Intronic
1141489147 16:84360223-84360245 TGGCAATGTTCTGGAATTAGAGG - Intergenic
1141726676 16:85794031-85794053 TGGAATTGTTTTTGATAAAGGGG - Intronic
1142049527 16:87949249-87949271 TGGGAATGTTTTGAAACAACAGG + Intronic
1145038773 17:19560954-19560976 TAGGAATTTTTTTTAAAAAGAGG + Intronic
1145406825 17:22607005-22607027 TCGGAATGTTTATGATTAACTGG - Intergenic
1148333924 17:46829059-46829081 TGAAAATGTTTTGGAATTAGTGG + Intronic
1148550302 17:48546338-48546360 GGGGAAGATTTTTAAATAAGTGG + Intergenic
1149594782 17:57858374-57858396 TGGTGATGTTTTTGAGCAAGTGG + Intergenic
1150002010 17:61446813-61446835 TGGGGATATTTCTGAATGAGGGG - Intergenic
1151057094 17:71045153-71045175 TGGGAATGTTTTCGATTAACAGG - Intergenic
1153843302 18:9026373-9026395 TGGGGAAGATTTGGAATAAGTGG - Intergenic
1155364334 18:25035295-25035317 TGGGAGTGACTTTGAAGAAGAGG - Intergenic
1155582544 18:27325572-27325594 TTGGAATTTTTTTGAATCTGTGG - Intergenic
1155685837 18:28549066-28549088 TGGGAAAGTCTATGAATATGTGG + Intergenic
1158548054 18:58412455-58412477 TGGGCAGGGTTTTGAAAAAGAGG - Intergenic
1159163914 18:64678663-64678685 TTGAAATAGTTTTGAATAAGAGG + Intergenic
1159202749 18:65208057-65208079 TTGGAATGTGCTAGAATAAGTGG + Intergenic
1159421020 18:68219591-68219613 TGGGAATATTATTGGATCAGAGG + Intergenic
1160893570 19:1392396-1392418 TGAGAATGTTCTGGAATTAGAGG - Intronic
1166881188 19:45931058-45931080 TGGCAATGTTTCTGAATACCAGG + Intergenic
1168145399 19:54417218-54417240 TGTGAGTGTGTTGGAATAAGTGG - Intronic
926818378 2:16824414-16824436 TGTGAATGTTTTTGCATTAGAGG - Intergenic
927039584 2:19214745-19214767 TTGGAATGTTTTTAAAACAGAGG + Intergenic
927317922 2:21707225-21707247 TGGAGATGTTTTAGAATTAGTGG + Intergenic
928066446 2:28169215-28169237 TGTGAATGTCTTTGGTTAAGAGG + Intronic
929080947 2:38121579-38121601 TGAGAATGTTCTGGAATTAGAGG + Intergenic
929342064 2:40831996-40832018 TGGGAATGATTTAGAAAAACAGG + Intergenic
929372625 2:41245097-41245119 TGTGAACATTTTTAAATAAGAGG - Intergenic
930083888 2:47478709-47478731 TGTGAATGCTTTAGAATGAGTGG - Intronic
930721873 2:54645904-54645926 TGGGAAGAATTTTAAATAAGTGG - Intronic
932627690 2:73311758-73311780 TGGGAATGATTAGGAATAACTGG - Intergenic
933174551 2:79160372-79160394 TGGCAATGTGATAGAATAAGAGG + Intergenic
933699901 2:85247263-85247285 AGTGAATGTGTTTGTATAAGAGG - Intronic
933894012 2:86794197-86794219 TGGATATTTTTTTAAATAAGGGG - Intronic
934098057 2:88626253-88626275 TGGTTAGGTTCTTGAATAAGGGG - Intronic
934115091 2:88781509-88781531 TGTGTATGTTTTTGCAAAAGTGG + Intergenic
934631563 2:95930523-95930545 TGTGTATGTTTTTGCAAAAGTGG - Intronic
934802084 2:97174162-97174184 TGTGTATGTTTTTGCAAAAGTGG + Intronic
934833725 2:97562116-97562138 TGTGTATGTTTTTGCAAAAGTGG - Intronic
935316866 2:101843463-101843485 TGTAATTGTTTTTGAATAGGAGG + Intronic
937622550 2:124005570-124005592 AGAGAATGTTTTTGGAAAAGAGG + Intergenic
939067933 2:137506289-137506311 TGGTGAAGTTTTTGAAGAAGAGG - Intronic
939203747 2:139073163-139073185 AGGGAATGTCTTTGAACAAAAGG + Intergenic
939382447 2:141453374-141453396 TTGGAATGTTTTTGAACAATGGG - Intronic
940435195 2:153644740-153644762 TGAGAATGCATTTGTATAAGTGG - Intergenic
941779535 2:169429063-169429085 TGAAAATGTTTTGGAATTAGTGG + Intergenic
942497844 2:176558453-176558475 TGGGAATTTTCTTTATTAAGAGG + Intergenic
943792209 2:191945927-191945949 TGGTATTGTGTCTGAATAAGAGG - Intergenic
945960744 2:216132214-216132236 TCTGAATGTTTTTCAGTAAGAGG + Intronic
947684612 2:232071871-232071893 TGGGAATGTTTTTGAATAAGAGG + Intronic
1169821686 20:9718310-9718332 TTGAAATGTATTTGCATAAGGGG - Intronic
1169941708 20:10944924-10944946 TGTGCATGTTTTTGTGTAAGGGG + Intergenic
1172090440 20:32428034-32428056 TGTGTATGCTTTTGAAAAAGAGG - Intronic
1172520313 20:35561690-35561712 TTGCAATGCTTTTGAATAACAGG + Intergenic
1172933111 20:38600262-38600284 TGGGAAGGCAATTGAATAAGAGG - Intergenic
1174999972 20:55616700-55616722 TGGAAACGTTTTTGATTATGTGG - Intergenic
1175051812 20:56162426-56162448 TGGGGATGTTTCTAAATTAGTGG - Intergenic
1175432621 20:58916965-58916987 TTGGCATGTTTTGGAATCAGTGG - Intergenic
1178439288 21:32585246-32585268 TGGGAATGTTTCTGCGGAAGTGG + Intronic
1180942538 22:19668711-19668733 TTGTAATGTTTTTAAATTAGAGG + Intergenic
1182653937 22:31874513-31874535 TGAGGATTTTTTTTAATAAGTGG + Intronic
949439025 3:4060557-4060579 TGTTAATGTGTTTGAATATGGGG - Intronic
949495932 3:4632152-4632174 TGGGAATCTAGTTGAATAGGTGG + Intronic
950236051 3:11321083-11321105 TGGGAATGTTTTGGAAGTAATGG + Intronic
950387064 3:12668475-12668497 TGGAAATGTTTTGGAACTAGGGG - Intergenic
951259132 3:20485668-20485690 TGGAAATGTATGTGAATAATTGG - Intergenic
956238355 3:67101480-67101502 TGTATATGTTTTTGATTAAGTGG - Intergenic
956629966 3:71306764-71306786 GGGTAATGTTTTTAAATGAGTGG - Intronic
957133202 3:76249046-76249068 TGGGAATTCTTTGGAATAATTGG + Intronic
958180863 3:90059236-90059258 TGGGAAAGTGTCTGTATAAGAGG - Intergenic
958857789 3:99407698-99407720 TGTGAATTTTTATGATTAAGGGG + Intergenic
962748493 3:138415726-138415748 AGGGTATGTTATTGAAAAAGTGG - Intergenic
962982183 3:140500499-140500521 TTGGGATGTTTCTGAATCAGAGG + Intronic
963399819 3:144783999-144784021 TATGAATGTTTATGAATAAAGGG + Intergenic
964417637 3:156464570-156464592 AGGGAATTTTTTTTAATTAGAGG + Intronic
964981300 3:162684700-162684722 TGGGAATTATGATGAATAAGAGG - Intergenic
966325671 3:178750981-178751003 TGAGAATGTTTTTTAATATCTGG - Intronic
967171007 3:186823630-186823652 TGAGAATTTTTTTGACTTAGGGG + Intergenic
968341158 3:197957052-197957074 TGGAAATGTATTAGGATAAGAGG + Intronic
968863319 4:3190335-3190357 TTGGATTTTTTTTTAATAAGAGG - Intronic
973985597 4:56349243-56349265 TGGGTAAGTTTTTGAATTTGAGG - Exonic
974515670 4:62905438-62905460 CGGGAATGATTTTCAATAATGGG - Intergenic
975052362 4:69882203-69882225 TGGGGATATTTGTAAATAAGTGG - Intergenic
976056676 4:81077428-81077450 TGAGAACGGCTTTGAATAAGTGG - Intergenic
976610970 4:87029947-87029969 TGCTAATCTTTTGGAATAAGGGG + Intronic
978065183 4:104389858-104389880 TGGGAATTTTTTTTTATAAAAGG + Intergenic
979646690 4:123077873-123077895 TGGAAATGTTCTGGAATTAGTGG - Intronic
981051780 4:140316351-140316373 TGGGTATGTTTGTGAATCTGTGG - Intronic
981648796 4:147031582-147031604 TGTGATTGTTTATGAAAAAGAGG + Intergenic
982611337 4:157577253-157577275 TGGTAATGGTATTGAATCAGTGG + Intergenic
982722778 4:158876564-158876586 CTGGAATGATTTTGAAGAAGAGG - Intronic
983518469 4:168680880-168680902 TGGTTCTGTTCTTGAATAAGAGG - Intronic
984221228 4:176979528-176979550 TAGGATTGTTGTTGAATTAGAGG - Intergenic
985637351 5:1043807-1043829 TGGGCAAGTTTGTGAATGAGTGG + Intergenic
985661296 5:1158225-1158247 TGGAAATGTATTTGAATAATAGG - Intergenic
988014373 5:25534520-25534542 TGGTAAGTTCTTTGAATAAGTGG - Intergenic
989965266 5:50459584-50459606 TGTGAATGGTTTAGAATAATTGG + Intergenic
990001648 5:50900175-50900197 TGGGAAAGTTTGTGGAAAAGAGG + Intergenic
990668162 5:58096883-58096905 TGGGACTGTTTTTAAATAATGGG + Intergenic
991568298 5:68028287-68028309 TGTGAGTGTGTTTGAATATGTGG - Intergenic
992524511 5:77595281-77595303 TAAGAATGTTTATGAATATGGGG + Intronic
993160552 5:84285124-84285146 TTTGAATGTTCTTGAATAAGTGG + Intronic
993551576 5:89279993-89280015 TGGTGATGTTTATTAATAAGTGG + Intergenic
993685473 5:90932189-90932211 TGTGAATGTTTTTTCATTAGTGG + Intronic
993698507 5:91091173-91091195 TGGGATTGTTTTTTAATGGGAGG - Intronic
993775066 5:91983698-91983720 TGTGAATGTCTTTGAGTATGGGG - Intergenic
994095916 5:95847276-95847298 TGGGATTGTTTTTGGAGAAAGGG - Intergenic
994957239 5:106547681-106547703 TATGAATGATTTTGAATAACAGG - Intergenic
995136871 5:108688495-108688517 TGTGAATATATTTGAATAAGTGG - Intergenic
995856136 5:116594315-116594337 TGGAAATGTTTTTCAAAAGGGGG - Intergenic
996779345 5:127168492-127168514 TGATAAAGTTTTTTAATAAGTGG + Intergenic
999493408 5:152073568-152073590 GTGGAATGATTTTGAATAGGGGG + Intergenic
999962505 5:156771937-156771959 TTGGAGTGTTTAAGAATAAGCGG - Intergenic
1000621045 5:163487473-163487495 TGGAATGGTTTTTGAATAATTGG + Intronic
1002665714 5:180822935-180822957 TAGGAATTTTTCTGTATAAGAGG + Intergenic
1004535171 6:16493416-16493438 TGAGAAAGTTGTAGAATAAGAGG - Intronic
1005177911 6:23069142-23069164 AGGGAATGTTTTTGACAAATTGG - Intergenic
1008470730 6:51881361-51881383 AGGGAATTTTGTTAAATAAGTGG - Intronic
1008627132 6:53327584-53327606 TGAAAATGTTTTGGAATTAGAGG + Intronic
1011150876 6:84272012-84272034 AGGGAATGTTTGCAAATAAGTGG + Intergenic
1011600164 6:89052520-89052542 TGGGACTGTTTCTGAATAAGAGG - Intergenic
1012334464 6:98037637-98037659 TGCGAACGTTTGTGAATAAAAGG - Intergenic
1012839567 6:104312371-104312393 TAGGAAAGTTTTTGAATGACAGG + Intergenic
1016144815 6:140656733-140656755 TGAGAATGATTTTGAATTTGTGG - Intergenic
1016329425 6:142941367-142941389 TGGCAATGCTTATGAAAAAGAGG - Intronic
1019793538 7:3033145-3033167 TGGGACTGTATTTGAAGACGGGG + Intronic
1020965130 7:14856745-14856767 TGGGTATGTTTTTGCATTATTGG - Intronic
1021529341 7:21626168-21626190 TGGGAATTTTTTTTAAAAAGCGG - Intronic
1022177713 7:27887755-27887777 TGGGAAGGTTTTTTTCTAAGTGG + Intronic
1023021525 7:36015976-36015998 AGGGAATGTTTTGGTATAATAGG - Intergenic
1024195546 7:47054869-47054891 GGGGAATGTTATTGAAGAAATGG + Intergenic
1024357545 7:48430086-48430108 TGGACATGTTTGTGAATAATTGG + Intronic
1024665706 7:51544863-51544885 TGGAAATGTTTTTGAACTAAAGG + Intergenic
1024687024 7:51757233-51757255 TGGGAATTTTGTTAAATAAGTGG - Intergenic
1025026789 7:55522839-55522861 TGGGAATGCTTTAGACCAAGAGG - Intronic
1027428762 7:78088492-78088514 TGGGACTGTTTTCGAAGAATGGG + Intronic
1027842657 7:83333142-83333164 TGGCAATGTTGTTGATCAAGTGG + Intergenic
1028285365 7:88990304-88990326 TGGGTATTTTTTAAAATAAGTGG + Intronic
1029971534 7:104794418-104794440 GGGGAATGGTGTTGAATAACTGG + Intronic
1031030677 7:116730804-116730826 TGGGCATGTTGTTGAATCTGAGG + Intronic
1031223455 7:119003148-119003170 TGGGAAAATTTGTGAATAATTGG + Intergenic
1031380552 7:121080464-121080486 TGAGAATTTTTTTGCAGAAGTGG + Intronic
1031425014 7:121594834-121594856 TGGGATTTTTTTTAAATAATAGG - Intergenic
1033452397 7:141473496-141473518 TGGGATTTTTTTTTAAAAAGAGG - Exonic
1033474564 7:141678873-141678895 AGGGACTGTTATTGAATAAAGGG - Intronic
1034000166 7:147402921-147402943 TTGGAATGTCTTTGGCTAAGGGG - Intronic
1034486503 7:151368000-151368022 TGGGAATGTTTTTTAAAAGGAGG - Intronic
1034562706 7:151891595-151891617 TGGGAATGTTCTTGACTCACAGG - Intergenic
1035075108 7:156172519-156172541 TGACAATGTTTATGACTAAGAGG - Intergenic
1035121920 7:156576080-156576102 TGGGAATGCTTTTAAGTAAAAGG - Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1036068621 8:5413994-5414016 TGTCAATGTTTCTGAATAAATGG + Intergenic
1036121654 8:6024380-6024402 TGGGAAAGTTTTAGAAGAAATGG - Intergenic
1036954148 8:13169374-13169396 TGTGAATGTTTTTGTAAAATGGG + Intronic
1037682567 8:21109740-21109762 AGAGAATGCTTTAGAATAAGGGG + Intergenic
1039257460 8:35734736-35734758 TGGGAATGTTTTTGAGGGAGGGG + Intronic
1040082891 8:43307090-43307112 GGGGAATGTTTTAGACTATGTGG + Intergenic
1040710937 8:50188116-50188138 TGAGAATGATTGTCAATAAGTGG - Intronic
1041165401 8:55087394-55087416 CAAGTATGTTTTTGAATAAGTGG - Intergenic
1041330923 8:56723979-56724001 TGGAAATGTTTTTAAAAAAAAGG + Intergenic
1041814460 8:61952912-61952934 TGGGAATCTGAATGAATAAGTGG - Intergenic
1042550318 8:69988610-69988632 AGGGAATGTTTTGAAATAAATGG + Intergenic
1043113182 8:76214152-76214174 TGAGAATGTTTGTAAATAAAGGG + Intergenic
1043696704 8:83228739-83228761 TGGAAATGTTTTTGAACAAATGG - Intergenic
1045658596 8:104412362-104412384 TGCGAATGTTTGTGAAAATGTGG + Intronic
1047480651 8:125279038-125279060 GGGGAAGTTTTTTAAATAAGTGG + Intronic
1048681002 8:136842016-136842038 TGGTTATGTTTTTAAATAACTGG - Intergenic
1049210101 8:141382095-141382117 TGGAAATGTTTTGGAAGCAGAGG - Intergenic
1049865961 8:144936013-144936035 TGGGAATGTTTTGAAAATAGAGG - Intronic
1050138663 9:2494989-2495011 TGGAAATGATATTGAATAAAAGG + Intergenic
1050274290 9:3980634-3980656 TGATAATGTTTTTTAATCAGAGG + Intronic
1051029193 9:12654152-12654174 TGGGAATGGGTTGGAATAGGAGG - Intergenic
1051554897 9:18372349-18372371 TGGGATTCTTTTGGAATAATGGG + Intergenic
1051981638 9:23026878-23026900 TGAGAGTATTTTTGAATGAGTGG + Intergenic
1052455925 9:28698338-28698360 TGATAATTTTTTTGAATAACAGG - Intergenic
1052701147 9:31939312-31939334 TCAGAATGTCTTTGAAGAAGTGG - Intergenic
1052985615 9:34485055-34485077 TGGGAGTGTTTGTGAATGAAGGG + Intronic
1054758818 9:68986182-68986204 TGGGAATGTATTTGATAAAACGG - Intronic
1055190173 9:73510356-73510378 TTGGAATATTTTTGAATAAATGG + Intergenic
1058657396 9:107236037-107236059 TGGCAATGCTTTAGACTAAGGGG + Intergenic
1059243594 9:112830142-112830164 GAGAAATGTATTTGAATAAGGGG + Intronic
1203582459 Un_KI270746v1:23237-23259 TGTGTATGTTTTTGCAAAAGTGG + Intergenic
1187167846 X:16821526-16821548 CGGGAAGCTTTTAGAATAAGTGG + Intronic
1188872962 X:35397306-35397328 TTGGTATGTTTTTGAATACCAGG - Intergenic
1192860258 X:75060850-75060872 TCAGAATGCTTTTGAAAAAGAGG - Intronic
1195321967 X:103727917-103727939 TGGGAATGTTTCTGCACAGGTGG - Intronic
1195757377 X:108212778-108212800 TGGGCATGTATTTTACTAAGTGG - Intronic
1196803699 X:119565944-119565966 TGGAAATGTTCTGGAATTAGTGG - Intergenic
1196966032 X:121055969-121055991 TTGGAATGTGTTTGAATATTTGG + Intergenic
1197322428 X:125049178-125049200 TGGGAATGTTTTGGAATTAGTGG - Intergenic
1197461254 X:126743968-126743990 TTGGAATATTTTTTAAAAAGTGG + Intergenic
1197825427 X:130585044-130585066 TGAAAGTGTTTGTGAATAAGTGG - Intergenic
1198380731 X:136080989-136081011 TGACAATGTTTTAGAATTAGTGG - Intergenic
1199141220 X:144315273-144315295 TGGAAAAGTTTTTGAAGAATTGG - Intergenic
1199307918 X:146289444-146289466 TGGAATTGTTTCAGAATAAGTGG + Intergenic
1199544899 X:148997812-148997834 TGAGGATGGTTTTGAATTAGGGG - Exonic
1200425443 Y:3015495-3015517 TTGGAATGTTTTTGGCTGAGAGG + Intergenic
1201201263 Y:11542499-11542521 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201201653 Y:11545860-11545882 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201202957 Y:11557190-11557212 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201203606 Y:11562757-11562779 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201204252 Y:11568334-11568356 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201204901 Y:11573936-11573958 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201205552 Y:11579543-11579565 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201206200 Y:11585149-11585171 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201206849 Y:11590751-11590773 TGGGAATGGTATTGAATGAAAGG + Intergenic
1201257716 Y:12125364-12125386 TGGGAATGTGTTGGAACAAGTGG - Intergenic