ID: 947693211

View in Genome Browser
Species Human (GRCh38)
Location 2:232159289-232159311
Sequence ATGGTGTCCTGCAAGAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947693211 Original CRISPR ATGGTGTCCTGCAAGAGTGG TGG (reversed) Intronic
900893234 1:5464831-5464853 GTGCTCTCCTGCAGGAGTGGTGG - Intergenic
901319097 1:8328909-8328931 ATGGTGTCTTTCAGGAGGGGAGG + Intronic
902840771 1:19072472-19072494 CTGGTCTCCAGCAGGAGTGGAGG - Intergenic
902840777 1:19072500-19072522 CTGGTCTCCAGCAGGAGTGGAGG - Intergenic
904096812 1:27985430-27985452 ATGGTGTCTTGAAAGAATGAAGG - Intronic
906448751 1:45925515-45925537 GTGGTGTCCTTGAAGAGAGGAGG + Intronic
908997909 1:70180286-70180308 ATGGTGACCTCCCATAGTGGGGG - Intronic
911406246 1:97443930-97443952 TAGGTGTCCTGCAAGCGAGGAGG - Intronic
916514069 1:165498819-165498841 ATGGTGTCATGGAAGACTGTGGG - Intergenic
917597001 1:176539280-176539302 ATGGGGTCCAGCCAGAGAGGCGG + Intronic
919937915 1:202266841-202266863 ATGGTGTGCACCAAGAGTTGAGG - Intronic
920921776 1:210303440-210303462 ATGGTGGCCTGCACCTGTGGAGG - Intergenic
921320263 1:213931739-213931761 ATAGGCTCCTGAAAGAGTGGGGG - Intergenic
923785944 1:237069705-237069727 ATGGTGTCAGGCAAGAGTTTAGG + Intronic
1063428086 10:5965256-5965278 ATGGTGTCCAGCAGGGGTGAGGG - Intronic
1063428946 10:5971920-5971942 TTGGAGTCTTGCAAGAGTTGAGG + Intronic
1063887880 10:10598105-10598127 ATGGTGTCCAGAGAGAGTTGGGG + Intergenic
1066003260 10:31124353-31124375 CTGATCTCCTGCAAGAATGGAGG + Intergenic
1070312414 10:75283399-75283421 AGCATTTCCTGCAAGAGTGGTGG + Intergenic
1071565706 10:86670357-86670379 AAGGAGTCCTGCAAGCATGGGGG - Intronic
1072041221 10:91608682-91608704 ATGCTGTCTGGCAAGAGTGGCGG - Intergenic
1073077513 10:100833520-100833542 ATGGAGTCCTGGAAGAGAGGAGG + Intergenic
1074164409 10:110862327-110862349 ATGATGTACTGCCACAGTGGTGG + Intergenic
1074579890 10:114708931-114708953 ATGCTGACCTGGAAGAGGGGAGG - Intergenic
1082893687 11:58167016-58167038 ATGGAGACCTGCAAGGGTGAGGG - Intronic
1087315843 11:96601217-96601239 ATGGTGACCTGCTGGCGTGGAGG + Intergenic
1089283115 11:117388189-117388211 AGGGTGGCCAGCAAGAGGGGAGG - Intronic
1090491246 11:127162715-127162737 TTGGGGTCCTGCAAGGCTGGGGG + Intergenic
1093272048 12:17075514-17075536 AAGGTGGCCTCCAAAAGTGGAGG - Intergenic
1093612951 12:21184395-21184417 AAGGTGTTCTGCAAGATTGATGG - Intronic
1099039315 12:77631286-77631308 CTGGTGTCCTGAAAGAGTTAAGG - Intergenic
1100308794 12:93376032-93376054 ATGGTGGCATGCAACTGTGGTGG + Intergenic
1100428813 12:94512159-94512181 ATGCTGGGCTGCAAGAGAGGTGG - Intergenic
1102880730 12:116482636-116482658 ATGGGGGCCTGCAGGAGTGGGGG - Intergenic
1105650329 13:22370359-22370381 GTTGTGTCCTGCCAGATTGGTGG + Intergenic
1107446299 13:40472773-40472795 CAGGTGTCCTGGAAGCGTGGGGG - Intergenic
1107778391 13:43872809-43872831 ATGGTGTCAAGCAAGGTTGGTGG - Intronic
1108026493 13:46183651-46183673 CTGGTGTCCTGAAAGAATGTAGG - Intronic
1113774572 13:112935770-112935792 ATGAAGTCATGCAGGAGTGGGGG + Intronic
1116970697 14:51061895-51061917 CTGGAGTCCTGCAATAGTAGGGG - Intronic
1117678539 14:58179903-58179925 ATGGCGACCTCCAGGAGTGGAGG + Intronic
1122935538 14:104954371-104954393 CTGGGGTCCTGGAAGAGTTGGGG - Exonic
1124187368 15:27542225-27542247 ATGGAGTTTTGCAAGAGTGGAGG - Intergenic
1125556468 15:40589750-40589772 GAGGTGTCCTGCAATAGTTGAGG + Intergenic
1128492518 15:68162964-68162986 ATGGTGTCCGCCAAGATTGAGGG + Intronic
1128911153 15:71516153-71516175 GTGGTGTCCTGGAAGAGGAGAGG + Intronic
1129743382 15:78001132-78001154 AGGGGGTCCTTCAGGAGTGGTGG - Intronic
1131541294 15:93277522-93277544 GTGGTATCCTGCAAGAGTGGAGG + Intergenic
1136777707 16:32880594-32880616 ATGGCGTCCTGGAGGGGTGGAGG + Intergenic
1137537266 16:49336840-49336862 ATGGTGTCCTGTGAGGATGGCGG - Intergenic
1138861190 16:60759531-60759553 ATGGTGGCAGGCAAGAGAGGTGG + Intergenic
1141786178 16:86202260-86202282 AGGGTGCCCTGCCAGGGTGGGGG + Intergenic
1142188064 16:88703892-88703914 CAGCTGTCCTGCACGAGTGGAGG + Intronic
1203080123 16_KI270728v1_random:1142703-1142725 ATGGCGTCCTGGAGGGGTGGAGG + Intergenic
1152029379 17:77832266-77832288 AGGGTGTCAGGCCAGAGTGGAGG - Intergenic
1155140741 18:23042118-23042140 ATGGTGTCAAGCAGGAGTAGGGG + Intergenic
1155743180 18:29315916-29315938 ATGGTGTATTTCAACAGTGGGGG - Intergenic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1158747986 18:60224025-60224047 ATGGTGTACAGCAAATGTGGTGG - Intergenic
1158905294 18:62005750-62005772 AAAGTTTGCTGCAAGAGTGGAGG - Intergenic
1160303519 18:77708678-77708700 ATCGGCTCCTGCAAGTGTGGAGG + Intergenic
1161202945 19:3025901-3025923 ATGCTTTCCTGCATGTGTGGGGG - Intronic
925288819 2:2732972-2732994 ATGGTGTGGGGCAGGAGTGGGGG - Intergenic
927284554 2:21343221-21343243 ATGGTGTGCTGAAAGAGAAGTGG + Intergenic
928649232 2:33387451-33387473 ATGGTTTCATGCAAAAGTGCTGG + Intronic
928699435 2:33883811-33883833 ATGGAGTCCTACATGAGTGACGG - Intergenic
929548617 2:42874963-42874985 AGGCTGTAGTGCAAGAGTGGAGG + Intergenic
937792376 2:125975862-125975884 ATAGTGCCATGCAAGAGTGGTGG + Intergenic
941186213 2:162324450-162324472 ATGGTGGCCTGCCAGTGTGCTGG + Intronic
947693211 2:232159289-232159311 ATGGTGTCCTGCAAGAGTGGTGG - Intronic
948258663 2:236586745-236586767 ATGGTGGCCGGCAAGAGAGAAGG - Intergenic
948602609 2:239115928-239115950 ATGGAATCCTGCAAGAAAGGAGG - Intronic
948918056 2:241048300-241048322 ATGGTCTCCTGCAAGAAAGACGG - Exonic
1168981219 20:2005677-2005699 AAAGTGTTCTGCAAAAGTGGTGG - Intergenic
1169159209 20:3361949-3361971 AAGTTGTCCTGCAAGAGTTTCGG - Intronic
1169171412 20:3468759-3468781 ATGGGGTCCTGCCAGAGGGTAGG + Intergenic
1173618503 20:44418592-44418614 ATGGTGGCATGCAAGGGTGAGGG + Intronic
1174560841 20:51429575-51429597 ACTGTGTTCTGCAAGAATGGAGG - Intronic
1175626767 20:60495009-60495031 CTGGTGTCATGCAGGAGTTGTGG + Intergenic
1175745062 20:61450810-61450832 CTGCTGTGCTCCAAGAGTGGAGG + Intronic
1178382354 21:32121360-32121382 ATGGTGTCCTGCAGGCCTAGCGG + Intergenic
1180178675 21:46106691-46106713 ATGGTGGCCTTTCAGAGTGGTGG - Intronic
1184929535 22:47670821-47670843 TTGGTGGCCTGAAAGAGTGCAGG + Intergenic
953004365 3:38964366-38964388 ATGGTGTTCTGCAGTAGAGGCGG - Intergenic
953482260 3:43261787-43261809 ACGGGGTCCTGCAAGAGAGGAGG + Intergenic
957951431 3:87132223-87132245 ATGGTGCCCTTCCAGATTGGGGG + Intergenic
959738149 3:109685032-109685054 ATGGTGGCAGGCAAGAGAGGGGG - Intergenic
961390861 3:126551602-126551624 ATGCTGTACTCCAAGGGTGGAGG - Intronic
964932694 3:162046019-162046041 ATACTGTATTGCAAGAGTGGGGG - Intergenic
965798938 3:172471282-172471304 ATCTTGTCCTGCAGTAGTGGGGG - Intergenic
970587925 4:17532086-17532108 TTGGTGTATTGCAAAAGTGGTGG - Intergenic
974896257 4:67943023-67943045 ATGATTTCCTGCAAGGGGGGAGG + Intronic
982368805 4:154610566-154610588 ATAGCAACCTGCAAGAGTGGCGG + Intronic
983389586 4:167112497-167112519 ATGTTTTCCTGCAAGAGTCCTGG - Intronic
984804812 4:183742007-183742029 ATGGTTCCCTGTAGGAGTGGAGG - Intergenic
985654282 5:1121879-1121901 ATGGGGTTGTGCAAGTGTGGGGG + Intergenic
986388332 5:7261303-7261325 AGGGATTCCTGCAGGAGTGGGGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
991467144 5:66925652-66925674 ATGCTGTCCTGCTGGAGTGGAGG + Intronic
992568357 5:78025233-78025255 GTGGTGTCCTTCAGGAGTGTTGG - Intronic
996353790 5:122575029-122575051 ATAGTGGCCTGCAAGGGCGGGGG - Intergenic
996437344 5:123449466-123449488 GTGTTGTCCTGTAAGAGTTGGGG - Intergenic
998299772 5:141006646-141006668 ATGGTGTCCTGAAAGAGTGGTGG + Intronic
1001016955 5:168150433-168150455 ATGGCGTCCTGCCTGAGTGGTGG - Intronic
1002993905 6:2264829-2264851 CTGGTCTCATGCATGAGTGGAGG - Intergenic
1004055733 6:12136444-12136466 ATTGTTTCCTGCAAGAGGTGTGG - Intronic
1005307348 6:24526374-24526396 ATAGTGTCCTGCAAGAGTTTTGG + Intronic
1005889673 6:30126989-30127011 GTGGTGTCTTGAAAGATTGGGGG + Intergenic
1006899812 6:37492798-37492820 ATGGTCTCTGGCAAGAGTGCAGG + Intronic
1006934191 6:37705835-37705857 AGCGTGGCCTGCAGGAGTGGGGG - Intergenic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1010415060 6:75602525-75602547 ATGGCGGCCGGCAAGAGCGGCGG + Exonic
1012734455 6:102921185-102921207 ATGGTCTCCTGAAAGACTAGTGG + Intergenic
1012762714 6:103321824-103321846 ATGGTGTCATTCAAGAGATGTGG + Intergenic
1014333480 6:120101158-120101180 ATAGACTCCTGCAAGAGTAGGGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1020027199 7:4907520-4907542 ATGGTCTTCTTCAAGAGTGACGG - Exonic
1025093126 7:56079294-56079316 AAGGAGTCTTGCAAGAGTAGGGG - Intronic
1029536501 7:101160591-101160613 ATGGGGTCCTGGCAGCGTGGCGG + Exonic
1031821031 7:126501807-126501829 ATGGGGTCCAGGAAGAGTCGGGG + Intronic
1032172948 7:129600892-129600914 GTAGTGTCCTTTAAGAGTGGTGG - Intergenic
1033032158 7:137837637-137837659 ATGGTGTCCTCACAGGGTGGAGG - Intronic
1033122239 7:138676424-138676446 CTCGTGTCCTTCGAGAGTGGAGG + Intronic
1033361535 7:140641395-140641417 ACGGTGTCCTGCGTGAGTGGGGG - Intronic
1036198332 8:6743583-6743605 ATGGGGTCCTGCAGAAGTGCAGG + Intronic
1036646701 8:10615447-10615469 ATGGTCTCAGGCAACAGTGGTGG - Intronic
1040638526 8:49303985-49304007 ATGCTGGCCTCTAAGAGTGGAGG - Intergenic
1043040319 8:75254203-75254225 ATGGTGGCCAGCAAGAGAGAAGG + Intergenic
1045694958 8:104798573-104798595 ATGCTTTCCTTCAAAAGTGGAGG + Intronic
1046102946 8:109635482-109635504 ATGGTGACCAGCAGAAGTGGAGG - Intronic
1048830007 8:138466533-138466555 ATGCTTTCGTGGAAGAGTGGGGG + Intronic
1051652088 9:19337700-19337722 TTGCTGACCTGCAAGGGTGGGGG + Intronic
1053158087 9:35793730-35793752 ATGGTGGACTCCAAGAGGGGTGG + Intronic
1053198957 9:36139842-36139864 TTGGTGTGCAGCAAGTGTGGTGG + Intronic
1055126298 9:72721640-72721662 ATGGGGTCCTGTAACAGTGCAGG + Intronic
1057406142 9:94772513-94772535 ATGGTGGCTTCCAAGATTGGGGG + Intronic
1059731211 9:117059069-117059091 AGGGTATCCTGCCAGAGTGATGG + Intronic
1061386992 9:130296210-130296232 CTGCTGCCCTGGAAGAGTGGGGG + Intronic
1062135896 9:134928158-134928180 ATGGTGTCCATCCAGATTGGGGG - Intergenic
1062365119 9:136204734-136204756 ACGCTGGCCTGCAAGAGTGCGGG - Intronic
1062372957 9:136249506-136249528 TTGGGGTCCTGGAAGAGTGTTGG - Intergenic
1187284044 X:17885890-17885912 AAAATGTCCTGGAAGAGTGGTGG - Intergenic
1189949029 X:46209797-46209819 AGGCTGTTCTGCAAGAGTGTGGG - Intergenic
1191257284 X:58285102-58285124 ATGGTGTCCTGCCAGAGGTCAGG - Intergenic
1193251547 X:79296960-79296982 TTGGTGTCCTGAAAGAGATGAGG + Intergenic
1196709938 X:118752285-118752307 ATGGTAGGCTGCAAGAGGGGCGG - Intronic
1200108749 X:153728292-153728314 CTGGTGTCCTGACATAGTGGTGG + Intronic