ID: 947693901

View in Genome Browser
Species Human (GRCh38)
Location 2:232166342-232166364
Sequence GTGCGCGCGCGCCCTGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947693899_947693901 24 Left 947693899 2:232166295-232166317 CCTTTGTTAAAATATATCTTAAA 0: 1
1: 0
2: 11
3: 103
4: 971
Right 947693901 2:232166342-232166364 GTGCGCGCGCGCCCTGTGAAAGG 0: 1
1: 0
2: 1
3: 5
4: 46
947693900_947693901 -7 Left 947693900 2:232166326-232166348 CCACACACACACACGCGTGCGCG 0: 1
1: 1
2: 16
3: 79
4: 452
Right 947693901 2:232166342-232166364 GTGCGCGCGCGCCCTGTGAAAGG 0: 1
1: 0
2: 1
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947693901 Original CRISPR GTGCGCGCGCGCCCTGTGAA AGG Intronic
900973270 1:6003091-6003113 GCGAGCGCCCGCCCCGTGAACGG - Intronic
921617885 1:217292947-217292969 GTGTGAGGGCGCCCTGTGATGGG + Intergenic
922220065 1:223551589-223551611 GTTCAAGCGAGCCCTGTGAAAGG - Intronic
923802893 1:237227696-237227718 GTGTGAGCGTGCCCTGTGATGGG + Intronic
924558195 1:245135066-245135088 GTTCGGGCACGCCATGTGAAAGG + Intergenic
1062889604 10:1048653-1048675 GGGCGCCCGCGCCCCGTGGAAGG - Intronic
1063413706 10:5856432-5856454 GTGCGCTGGCGCCCAGAGAAAGG + Intergenic
1065216799 10:23457012-23457034 GCGCGCGCGCGCACAGAGAATGG + Intergenic
1067939662 10:50643597-50643619 GTGTGAGCGCACCCTGTGATGGG + Intergenic
1070147673 10:73786354-73786376 GCGCGTGCGCGCGCTGTGACAGG + Intronic
1076097657 10:127745026-127745048 TTGCGCCCTGGCCCTGTGAAAGG - Intergenic
1083753614 11:64777794-64777816 GTGCGCACGCGCGCTGTGGGGGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1098288514 12:68933203-68933225 GGGCGCGCCCGCCCTCTGACCGG - Intronic
1108229213 13:48319450-48319472 GAGCGCTGGCGCCCTGAGAAGGG - Intronic
1111397219 13:87678535-87678557 CTGCGCGGGTGACCTGTGAAAGG + Exonic
1118403134 14:65397624-65397646 GTGCACGCCTGCCCTGTGATGGG + Intergenic
1124121795 15:26894333-26894355 GTGCAGGCGCGGCCTGTGAAGGG - Intronic
1124602581 15:31147651-31147673 GTGCGAGCGAGGCCTGTGTATGG + Intronic
1131622192 15:94080120-94080142 GTGTGAGCGTGCCCTGTGATGGG - Intergenic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1137855751 16:51792927-51792949 GCGCGCGCGCGCCCTAGGAAGGG - Intergenic
1141757053 16:85998229-85998251 GTGCGCAAGAGCCCTGTGTACGG - Intergenic
1150802435 17:68292217-68292239 GTGCGCGCGCGCCCCGGGCCGGG - Intronic
1152517285 17:80833099-80833121 GAGCGCGCCCGCCCCGGGAACGG - Intronic
1158991641 18:62874630-62874652 GTGCGTGCGCGCCCTGTGATGGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
936278871 2:111121441-111121463 CTGCGCGCGGGCCTGGTGAAGGG + Intronic
940902203 2:159136048-159136070 GTGCGCGCGCGCGCGTTTAAGGG + Intronic
941095505 2:161237015-161237037 GTGTGCGCGCGCGCGGAGAAGGG - Intergenic
942317962 2:174711796-174711818 GTGCGAGTGTGCCCTGTGATGGG + Intergenic
944996491 2:205300632-205300654 GTGCGGCCGGGGCCTGTGAAAGG - Exonic
947693901 2:232166342-232166364 GTGCGCGCGCGCCCTGTGAAAGG + Intronic
948910052 2:240998431-240998453 GCGGGCGCGCGCCCTGTGGTGGG - Intergenic
1173490547 20:43476543-43476565 GTGCACGCGCGCTCTGTGATGGG - Intergenic
1184661599 22:45967943-45967965 GTGCCCGCGCTGCCTCTGAAGGG - Intronic
951640600 3:24830445-24830467 GTGCGCGCGCGCCGTGGCTAAGG + Intergenic
1003778734 6:9398871-9398893 GTGGGGGCGCGCCCTGGGATGGG + Intergenic
1017344258 6:153361639-153361661 GTGTGAGTGCGCCCTGTGATGGG + Intergenic
1019750315 7:2725111-2725133 CTGCGAGCGCACCCTGTGAATGG + Intronic
1022230775 7:28410151-28410173 GTGGGCGCGCGCCCGGGGAGGGG + Intronic
1027316122 7:76986272-76986294 GTGGGCGCTCACCCTGTGAATGG - Intergenic
1035559327 8:593267-593289 GTGAGGGGGGGCCCTGTGAAGGG + Intergenic
1037951751 8:23023129-23023151 GTGGGCGCGCTCTCTGTGGATGG - Intronic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1041655579 8:60346566-60346588 GTGTGCGTGTGCCCTGTGATGGG - Intergenic
1048484258 8:134832346-134832368 GTGCGCGCGCGCGTGGGGAAGGG + Intergenic
1049457286 8:142700240-142700262 GGGCGCGGGAGCCCTGGGAAAGG - Exonic
1051079598 9:13279304-13279326 GTGCGCGGGCGCCCTGGGCTCGG - Intronic
1051174717 9:14350026-14350048 GTGCGTGCGTGCCTGGTGAAGGG - Intronic
1055308361 9:74952896-74952918 GTGCGCGCGCGCACTCTGTCTGG + Intergenic
1056946029 9:90997704-90997726 GTGTGCACGCGCCCTGCGATGGG + Intergenic
1187419435 X:19122182-19122204 GAGCCCGCGCGCCGTGGGAAAGG - Intronic