ID: 947698544

View in Genome Browser
Species Human (GRCh38)
Location 2:232213373-232213395
Sequence AAGGACATGGAAAAGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947698539_947698544 8 Left 947698539 2:232213342-232213364 CCTGAGGAGCAGTTTGGCAGAGC 0: 1
1: 0
2: 1
3: 12
4: 153
Right 947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG 0: 1
1: 0
2: 4
3: 43
4: 406
947698536_947698544 29 Left 947698536 2:232213321-232213343 CCACTTAGTTTTTCTTGCATTCC 0: 1
1: 0
2: 3
3: 25
4: 331
Right 947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG 0: 1
1: 0
2: 4
3: 43
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947698544 Original CRISPR AAGGACATGGAAAAGGAGTC AGG Intronic
901909796 1:12447074-12447096 CTGGACAAGGAAGAGGAGTCAGG - Intronic
902140410 1:14349174-14349196 AAGGATACTGGAAAGGAGTCAGG + Intergenic
903504107 1:23820826-23820848 TAGGCAGTGGAAAAGGAGTCTGG - Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903980713 1:27185850-27185872 ATAGAAATGGAAAAGGGGTCTGG + Intergenic
904228320 1:29043855-29043877 AAAGACAGGGAAAAGTAGTCAGG + Intronic
904330186 1:29753757-29753779 AGGGTCATGGCAGAGGAGTCAGG - Intergenic
905343717 1:37297112-37297134 AGGGCAATGGACAAGGAGTCTGG - Intergenic
905435782 1:37954271-37954293 AAGGAGATGGACAAGAAGCCTGG - Intergenic
905830256 1:41059856-41059878 AAGGACATGCAATAGGGGTGTGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906457458 1:46009351-46009373 AAGGACATGCAAATGGGGCCAGG - Intronic
906944319 1:50282865-50282887 GAGGCCATGAAAAAGGAGTTGGG + Intergenic
907407404 1:54262118-54262140 AAGAAAATGGAAATGCAGTCAGG - Intronic
907574657 1:55515221-55515243 AAGTACATTTATAAGGAGTCTGG + Intergenic
907902686 1:58755478-58755500 AAACACATGGAAAAGGCTTCCGG + Intergenic
908525046 1:64979862-64979884 AAGGACACTGAAAAAGAGGCAGG + Intergenic
908747571 1:67390872-67390894 AAGGTCTTGGAAAGGGAGCCTGG - Intronic
908788445 1:67757686-67757708 AAGGAGATGGAGAGGGAGTTTGG - Intronic
908799464 1:67864503-67864525 TAGGACATGGACAAGCAGCCAGG + Intergenic
908921682 1:69201751-69201773 AAGGACATGGAATTAGAATCTGG - Intergenic
909322862 1:74312150-74312172 ATGGACATGGAAAGAAAGTCGGG + Intronic
911372965 1:97016208-97016230 AAGGGCACAGGAAAGGAGTCAGG - Intergenic
911457229 1:98140861-98140883 GAGGAAATGGGAAAGGAGTATGG - Intergenic
912176972 1:107171323-107171345 ATGGACATGGAAAATGAGCAAGG - Intronic
912259176 1:108092304-108092326 ATAGGCATGGAAGAGGAGTCAGG - Intergenic
912381115 1:109248790-109248812 CAGGACATGGACAGGGAGGCAGG + Intergenic
912791613 1:112657485-112657507 ATGGACAAGGAAAAGGACACTGG - Intronic
914831593 1:151174623-151174645 AAGGCCAGGGGAAAGGTGTCCGG - Intronic
915456307 1:156043108-156043130 AAGTAAATGGAAAAGGGGCCAGG - Intronic
915525519 1:156473742-156473764 AAGGACATGAGAAAGGTCTCTGG - Intronic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
918428606 1:184435723-184435745 AAGGACATAGGAAAGGAGCCTGG + Intronic
918630116 1:186707273-186707295 AAACACATTGGAAAGGAGTCTGG - Intergenic
919365188 1:196650641-196650663 AAGGACATGCAACAGGTGTGCGG - Intergenic
919947250 1:202328616-202328638 AAGGACAAGGAAGAGGTGTGGGG - Intergenic
919992947 1:202721553-202721575 AAGGACATGGGATTGGAGTCTGG + Intergenic
920038259 1:203079711-203079733 AAGGACAAGGCACCGGAGTCAGG - Intergenic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921722971 1:218494024-218494046 AAGCACATGGAATGGGAATCAGG - Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
924063533 1:240200791-240200813 GAGAACATGGAAAAAGAGTTGGG - Intronic
924773387 1:247096533-247096555 AAGGAAAGAGAAAAGCAGTCAGG - Intergenic
924916766 1:248577980-248578002 AATGACAAGGAAAAAAAGTCTGG + Intergenic
1062930975 10:1352376-1352398 AAGGAAGTGGAAGAGGAGTGGGG - Intronic
1063972939 10:11394086-11394108 AGCGGCATGGCAAAGGAGTCAGG - Intergenic
1064381312 10:14843964-14843986 GAGGACACAGAAAAGGAGCCAGG - Intronic
1064786349 10:18901350-18901372 AAGGTCATGGAAAAGCACTTGGG + Intergenic
1066060779 10:31721843-31721865 AAGGTCATGGAAAAGAAGTCTGG - Intergenic
1066114548 10:32227931-32227953 AAGAAGATGGAAAAGCAGACTGG - Intergenic
1067932003 10:50571452-50571474 CAGGAAATGGAAAAGGTGCCAGG - Intronic
1068179809 10:53503545-53503567 AGAGACATGGAAAAGGGGTGGGG + Intergenic
1068220762 10:54042691-54042713 AAGGCTATGAAAAAGGAGTTTGG + Intronic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069727290 10:70588841-70588863 AAGGGCAGGGAAAGGGAGTGAGG + Intergenic
1071508433 10:86246609-86246631 AGGGACCTGGAAAAGGAGGCAGG - Intronic
1072329224 10:94330173-94330195 AAGGTCATGGAGGAGGAGTGGGG - Exonic
1072826803 10:98614861-98614883 AATGACATGGAAAAGGGATTGGG + Intronic
1073456143 10:103637867-103637889 GAGGTCATGGGAAAGGGGTCAGG - Intronic
1074994975 10:118748938-118748960 AAGGAAAAGGAAGAAGAGTCAGG + Intronic
1075485061 10:122815096-122815118 AAGGACTTTGGATAGGAGTCAGG - Intergenic
1076283997 10:129275719-129275741 AAGTCCATGGAAAAGGATACAGG - Intergenic
1076843829 10:133059474-133059496 AAAGACATGGAAATGGAGGCCGG - Intergenic
1077302488 11:1853738-1853760 AAGGACAAGGCCAAGGATTCTGG + Intronic
1079321071 11:19451826-19451848 AAGGACATGGAAATAGAAGCTGG + Intronic
1079565887 11:21881640-21881662 AAGGACATTAACAAGGAGTAAGG + Intergenic
1081156082 11:39692856-39692878 GAGGAGGTGGAAAAGGAGACAGG - Intergenic
1081355090 11:42102890-42102912 AAGGACATCGGAAAGGAGGTAGG + Intergenic
1081479766 11:43475017-43475039 AAGGAGATGGAAGGGGAGGCAGG + Intronic
1081789995 11:45775681-45775703 AAGGACAGGGGAAAGGAGATGGG + Intergenic
1081858090 11:46316543-46316565 ATGGGCTTGGAGAAGGAGTCTGG - Intronic
1082921688 11:58502253-58502275 ATGAACATGAAAAAGGAGACTGG + Intergenic
1082974045 11:59054652-59054674 AAGGACATGAAGATGGAGTGGGG + Intergenic
1082992327 11:59218075-59218097 CATGACATGGAAGAGGAGTGTGG - Intergenic
1087986312 11:104685308-104685330 AAGGAGAAGGAAAAGGACTTTGG - Intergenic
1088332748 11:108670316-108670338 AAGGAGAGGGAACAGGAGTAGGG + Intronic
1089856749 11:121552143-121552165 AAAGGCATGGAATAGGAGGCAGG + Intronic
1089876393 11:121725780-121725802 AAGGACAAGAAAAAGAAGCCTGG - Intergenic
1090446040 11:126765668-126765690 AAGGCCAGGCAAAGGGAGTCAGG + Intronic
1090792868 11:130106986-130107008 AAGCACATAAAAAAGGAATCTGG - Intronic
1090977865 11:131691565-131691587 AAGGACATGGAAGGGAAGTCGGG - Intronic
1092464676 12:8719910-8719932 AAGGAGACTGACAAGGAGTCTGG + Intronic
1093405269 12:18797184-18797206 ATGGAAATAGAAAAGAAGTCAGG - Intergenic
1094499315 12:31008377-31008399 AAGGACAGGGAAGAGGGCTCTGG - Intergenic
1095495890 12:42783300-42783322 ATGGGCATGGATAAGAAGTCAGG + Intergenic
1095632585 12:44395899-44395921 AAGGACATGGAACAAGTTTCAGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1098442588 12:70534284-70534306 AAGAAAGTGGAAAAGAAGTCAGG + Intronic
1099938559 12:89157725-89157747 AAGGAAATGGAAAATGATTATGG - Intergenic
1101541864 12:105672614-105672636 TGGGACATGGAAAAGGGGTGGGG + Intergenic
1101751814 12:107588239-107588261 ACCCATATGGAAAAGGAGTCAGG + Intronic
1102311954 12:111852278-111852300 AAGGGCATGGAAAGGAAGGCAGG - Intronic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1102445898 12:113002618-113002640 CTGGGCATGGAAAAGGAGTTTGG + Intronic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102889064 12:116544083-116544105 AAGGACTGGGAAAAGGAGATTGG - Intergenic
1103279994 12:119749559-119749581 AAGCAAATGGAAATGGAGTTTGG + Intronic
1104153844 12:126111131-126111153 AGTGTCATGGCAAAGGAGTCTGG + Intergenic
1104276858 12:127336966-127336988 AAGCACATGGTCAAGGAGTGAGG - Intergenic
1104283782 12:127404383-127404405 AAGGAAATGGAAATGAAGTCTGG + Intergenic
1104308292 12:127630402-127630424 AAGTCCATGGAAAAGTTGTCTGG - Intergenic
1106279877 13:28257251-28257273 AGGGAGAAGGAACAGGAGTCAGG + Intronic
1106541899 13:30697771-30697793 AAAGAAAGGGAAAAAGAGTCAGG + Intergenic
1107735919 13:43398618-43398640 AAGGAGATGGAAGGGGAGGCAGG - Intronic
1108261106 13:48657521-48657543 AAAGAGATGGAAAAGGAGAGAGG + Intronic
1109506875 13:63312909-63312931 AAGGAAATAAAAAAGGTGTCAGG + Intergenic
1109523663 13:63545756-63545778 AGCGACATGGCAAAGGAGACAGG + Intergenic
1109574864 13:64242070-64242092 AAGGTCATGGAAAATGAGGAAGG + Intergenic
1110099586 13:71580813-71580835 TAGGACATGAAAAAGGAGTTGGG - Intronic
1110180986 13:72616446-72616468 AAGCACATGGCTAAGGAATCAGG + Intergenic
1111355997 13:87103226-87103248 CAGGACATGCAAGAGGGGTCTGG - Intergenic
1111835293 13:93380683-93380705 ACTGTCATGGAAAAGCAGTCAGG + Intronic
1111897344 13:94157671-94157693 AAGGACTTGGAGGAGGAGACTGG + Intronic
1112393134 13:99003336-99003358 AAGGAGCTGGGAAAGGAGCCTGG - Intronic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1112661932 13:101520129-101520151 AAGTAGATGGAAAAGAAGACAGG - Intronic
1113835868 13:113328168-113328190 AAGGACAGGGACAAGGAGCCTGG - Intronic
1114488502 14:23080059-23080081 AAGGACTTGACAAAGGAGACAGG + Exonic
1114584752 14:23800365-23800387 AAGAACATAAAAAAGGAATCAGG - Intergenic
1116370474 14:44124338-44124360 AACAATATGGAATAGGAGTCAGG - Intergenic
1117931129 14:60841146-60841168 AAGGAAATGGAAAGGGAGAGAGG - Intronic
1119511286 14:75213505-75213527 CAGGACATGGAAACGGAGAGAGG + Intergenic
1120557398 14:85945638-85945660 AAGGACAAGGAAGACGAGTAAGG - Intergenic
1120751156 14:88199498-88199520 AAGAACCTGGAAAAGCAGCCAGG + Intronic
1121017123 14:90555631-90555653 AAGGGCAAGGAAAAGGACTCTGG - Intronic
1122094626 14:99362064-99362086 AAGAACAGGGCAGAGGAGTCAGG - Intergenic
1122104388 14:99441220-99441242 AAGGAGATATAAAAGGAGTGAGG - Intronic
1122184703 14:99982529-99982551 AAGGACTTTGGAAAGGAATCAGG + Intronic
1122655989 14:103259544-103259566 CAGGACATGGAATAGAAGTACGG - Intergenic
1122930166 14:104929495-104929517 CAGGACAAGGAAAAGAAGTGAGG + Intronic
1123927072 15:25125927-25125949 AAGGAAATGGAAAGGAAGGCAGG - Intergenic
1124875859 15:33592613-33592635 AAGGAGAAGAAAATGGAGTCTGG + Intronic
1125198027 15:37071094-37071116 AAGGACATTGAATAGCAGACTGG - Intronic
1125265170 15:37870716-37870738 AAGGTCATGGAAAAAGAGTTAGG - Intergenic
1126048042 15:44662960-44662982 AAGGACATGAAAAAAGTATCAGG + Intronic
1129028340 15:72600182-72600204 GAGGACATAGAAGAGGAATCAGG - Exonic
1129135005 15:73540750-73540772 GAGGACATTGCTAAGGAGTCAGG + Intronic
1129149242 15:73677312-73677334 AAGAACTTGGAAAAGGAGTAGGG + Intergenic
1129702360 15:77775177-77775199 AAGGCCATGGCCAAGGAGACTGG - Intronic
1129892118 15:79078264-79078286 AAGGAGATGGAAAAGGGAGCTGG - Intronic
1130134693 15:81172797-81172819 AAGGAAAAAAAAAAGGAGTCAGG + Intronic
1130353776 15:83112243-83112265 AAATCCATGGAGAAGGAGTCTGG - Intronic
1130388510 15:83434346-83434368 AAGAACTTGGAAAATGAGTTGGG + Intergenic
1130677436 15:85965802-85965824 TAGGACATGGAAATGGAGCAGGG + Intergenic
1131343550 15:91625521-91625543 AAGGAAATGGCAAAGCAGACAGG + Intergenic
1131971832 15:97901294-97901316 AAAGAAATGGAAATGGGGTCGGG - Intergenic
1133036069 16:3035131-3035153 GAGGACAAGGGAAGGGAGTCAGG - Intronic
1133491229 16:6271125-6271147 AAGAACATAGAAAAAGAGGCCGG + Intronic
1133803606 16:9105794-9105816 AAGGACATGGGAAAAGAATCTGG + Intronic
1137033248 16:35544169-35544191 ATGGAGATGGAGAAGCAGTCAGG - Intergenic
1137381666 16:48004971-48004993 AAAGACATGGAAAAGCAATGGGG + Intergenic
1137750143 16:50855297-50855319 AGGGGCATGGAACAGGAGGCAGG - Intergenic
1139025354 16:62810249-62810271 AAGGAGAGAGAAAAGGAGGCAGG - Intergenic
1140064505 16:71599627-71599649 AAGGAGAAGGAAATGGATTCCGG - Intergenic
1140962630 16:79931223-79931245 GAGGAGATGGAAGATGAGTCGGG - Intergenic
1141792753 16:86247979-86248001 ATGGAGATGGGAAAGGAGCCGGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1203113788 16_KI270728v1_random:1469540-1469562 AAGGAAAGGGAAAAGGAGAAGGG - Intergenic
1143368339 17:6422794-6422816 ATGGACAGGGCAAAGGAGACTGG + Intronic
1144658333 17:17052225-17052247 AAGGACAGGGAGGATGAGTCTGG - Intronic
1144806316 17:17970560-17970582 AAGGACATGGGGAAGAAGTAAGG + Intronic
1146394612 17:32454004-32454026 AAAGACAGGAAAAAGGAATCTGG + Intronic
1146597348 17:34181743-34181765 AAGGAGATGAAAAAGAAGTCGGG + Intergenic
1146850483 17:36217311-36217333 AGGGACTTGGAAAAGGAGAGAGG + Intronic
1147400687 17:40178424-40178446 AAGGGCAAGGAAGAGGAGCCGGG - Intronic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148090417 17:45019766-45019788 ACAGACATGGAAGAGGAGACTGG - Intergenic
1148207905 17:45791188-45791210 AGAGACAGGGAAAAGGAGTGTGG + Intronic
1149273178 17:55004777-55004799 AAGGAGAAGGAAAAGAAGTGGGG + Intronic
1150848426 17:68682346-68682368 AAAGACATGGAAGAGGAGACTGG - Intergenic
1151274733 17:73025688-73025710 AAGAAGATCGAAATGGAGTCAGG + Intronic
1151282897 17:73089732-73089754 AAGGACAAGCAAAAGGACCCAGG + Intronic
1151363195 17:73600793-73600815 AAGGACAGGGAAAGGGTATCCGG - Intronic
1152611980 17:81320007-81320029 TAGGAGATTGAAAAGGAGCCTGG - Intronic
1153342848 18:3993226-3993248 AAAGAAAAGGAAAAGGAGTTTGG + Intronic
1153550800 18:6259583-6259605 AAGGAGATGGAGAAGGAGAAAGG - Intronic
1155090528 18:22504771-22504793 TAGGACAAGGAAAAGAACTCAGG + Intergenic
1156527292 18:37778751-37778773 CAGGACTAGGAAAAGGCGTCGGG + Intergenic
1156835901 18:41554109-41554131 AAGGAAAGGGAAAAGGGGTGGGG + Intergenic
1157631025 18:49095871-49095893 AAGGACACTGCAATGGAGTCTGG - Intronic
1158245812 18:55430983-55431005 AAGCAAAGGGAAAAGGAGTCAGG + Intronic
1159593361 18:70358723-70358745 AAGGAAGTGGAGAAGGAGGCAGG + Intergenic
1160109732 18:76015035-76015057 AATAACATGGAAAAAGAGACAGG - Intergenic
1160423322 18:78764223-78764245 AAAGACATTGAAAAGAGGTCAGG + Intergenic
1160965757 19:1746265-1746287 AAGGAAATGGAGGAGGAGTGGGG + Intergenic
1163499102 19:17664902-17664924 AAGCAAATGGAAAAGGTGCCAGG + Intronic
1163788109 19:19287848-19287870 AGGGAAATGAAAAAGAAGTCAGG + Intronic
1164441667 19:28284355-28284377 AAGGAGGAGGAAAAGGAGTGGGG + Intergenic
1164727418 19:30475686-30475708 AAGGACATGGAGAAGGGGCTGGG - Intronic
1165954994 19:39496968-39496990 AAATACAGGGAAAAGGAGCCTGG + Intergenic
1166303173 19:41923550-41923572 ATGGACAGGGACAAGGAGACAGG + Intronic
1167250765 19:48397305-48397327 AATGAGAGGGAAAAGGGGTCAGG - Intronic
1167386827 19:49168433-49168455 AGGGACTTGGAAAAGGGGGCTGG + Intronic
1167633029 19:50637617-50637639 ATGGACAAGGAAAAGGAATTAGG + Exonic
1167896842 19:52588575-52588597 AAGGGCAAAGAAAAGGAGCCAGG + Intergenic
1168625392 19:57914153-57914175 AAGGGCATGAAAGAGGAATCAGG - Intronic
925819903 2:7790057-7790079 AAGAACATGGAAAAGGCTCCAGG - Intergenic
926247242 2:11130474-11130496 AAGGACATGTAAAAAGAGACTGG + Intergenic
926962899 2:18378301-18378323 AAGGCCAAGGATGAGGAGTCAGG + Intergenic
927736476 2:25527225-25527247 AAGAAATTAGAAAAGGAGTCTGG + Intronic
928885538 2:36143847-36143869 AAGCCCATGGCAAGGGAGTCAGG - Intergenic
928916757 2:36480291-36480313 AATGAGCTGGAATAGGAGTCGGG - Intronic
929183660 2:39070400-39070422 AAGGACATGGAAAAGGAATAAGG - Intronic
930901654 2:56514065-56514087 ACTAACATGGGAAAGGAGTCTGG + Intergenic
931236452 2:60417066-60417088 AATGGCAGGGAAAGGGAGTCTGG - Intergenic
931648200 2:64444449-64444471 AAGGTCATGGAAAAGGAATTCGG + Intergenic
932301274 2:70668703-70668725 AAAGACATGGAGAAGGAATATGG + Intronic
932411254 2:71549318-71549340 AAAGAAATGGAAAAGGGGTTAGG - Intronic
932882434 2:75516356-75516378 AAGGAAATGGAAAAGCAGTGTGG - Intronic
933114798 2:78454982-78455004 AGGGGCATGGAAAAGGAGGGTGG - Intergenic
933174944 2:79164504-79164526 AAGGACCTTGAAAAGTGGTCAGG - Intergenic
934738457 2:96702398-96702420 AAGGGTAGGGAAGAGGAGTCAGG + Intergenic
935102999 2:100014659-100014681 AAGGAGATGGAAAAGAAGAAGGG + Intronic
936439776 2:112541861-112541883 AAGGAGGTGGGAGAGGAGTCGGG - Intergenic
938997936 2:136700601-136700623 AGGGACATGGAAAATGAAGCTGG + Intergenic
939085264 2:137710784-137710806 AGTGACATGGCAAAGGAGACAGG + Intergenic
939442535 2:142267968-142267990 TAGGAAATGGAAAAAGAGTCAGG + Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
942080882 2:172398489-172398511 AAGGACATGGGAATGGGGTGGGG + Intergenic
942799271 2:179858071-179858093 ATGGAGATGGGAAACGAGTCAGG + Intronic
943342307 2:186695062-186695084 AAGGAAAGGGAAAAGGAGAGGGG + Intronic
943385475 2:187199317-187199339 AAGGAGAAGGTAGAGGAGTCAGG - Intergenic
943448979 2:188024435-188024457 AAGGGGATGGCAAAGGAGCCTGG + Intergenic
944684490 2:202105986-202106008 ACAGCCAAGGAAAAGGAGTCTGG + Exonic
945767220 2:213995952-213995974 AAGGACAAGGAGAAAGAGTGAGG - Intronic
946225457 2:218261928-218261950 GAGGAGAGGGAAGAGGAGTCTGG - Intronic
946997125 2:225406210-225406232 AAGGGCATGGATAAGGAGGCTGG - Intronic
947292109 2:228587179-228587201 AAGGACATTGAAAAGCATTTTGG - Intergenic
947384125 2:229573674-229573696 AAGGAAATGGAAATGAAATCAGG + Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
948159841 2:235814694-235814716 AAGGACAGGGAAATGGAGGTGGG + Intronic
948297370 2:236871847-236871869 AGTGACTTGGAAAAGGAGACAGG - Intergenic
949066818 2:241996004-241996026 AAGCACATTGAGAAGGAGGCTGG - Intergenic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1169279778 20:4257114-4257136 AAGGAAATGGAAAATGGCTCTGG - Intergenic
1169826930 20:9778749-9778771 AAGGGCATAGAAAAAGAGTATGG - Intronic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170550848 20:17474738-17474760 AAGGGCATGGCAGAGGAGCCTGG - Intronic
1170565049 20:17595191-17595213 AAGGACAAGAAAAAGGGCTCTGG - Intronic
1170594042 20:17792271-17792293 AAGGACATGGGAAAGGAGGTGGG + Intergenic
1170614444 20:17937611-17937633 AAGGAAATGGAGCAGGAGACTGG - Intergenic
1171477014 20:25418569-25418591 AAGGACATAGGATTGGAGTCAGG + Intronic
1172106082 20:32518085-32518107 AAGGGCATGGACTTGGAGTCAGG - Intronic
1172298806 20:33833332-33833354 AAGGAAATGGAGACTGAGTCAGG - Intronic
1172606285 20:36216376-36216398 AAGCACACGGAGGAGGAGTCGGG + Intronic
1172916494 20:38447407-38447429 AAGGTCCTGGCAAAGGAGTCTGG - Intergenic
1172987806 20:39007030-39007052 AATGACTTGGAAATTGAGTCTGG - Intronic
1173123151 20:40312394-40312416 AAGGTTATGGAAAAGGATTTGGG - Intergenic
1173159919 20:40644762-40644784 AAGCAAATGGAAAGGGAGGCTGG + Intergenic
1173802446 20:45902858-45902880 AAGGACATCCACAAAGAGTCTGG - Intronic
1174609811 20:51789958-51789980 AAGGTCATCAAAAAGGAGCCTGG - Intronic
1175555059 20:59845989-59846011 ATGGCCATGGAAAAGAAGTGGGG - Intronic
1175724681 20:61309897-61309919 AAGGACATGGAGCAGAAGTGTGG + Intronic
1177219955 21:18179665-18179687 AAGTACAAGGAAAAGGAGAGTGG - Intronic
1177646106 21:23901387-23901409 TAGGACATGGCAAAGGTGACAGG + Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1179343119 21:40531354-40531376 AAGGACAGGTAAACGGAGACAGG - Intronic
1179398427 21:41062042-41062064 AAGGACAGGGAAAAGGGCTGGGG - Intergenic
1179843565 21:44093867-44093889 AAGGCCAGGCAAAGGGAGTCAGG + Intronic
1180164834 21:46019686-46019708 AAGGAGATGGGAAAGGAGGTGGG - Intergenic
1180750763 22:18122758-18122780 AGGGACATGGAGAAAGATTCAGG - Intronic
1181845055 22:25700110-25700132 AGGCACTTGGAGAAGGAGTCTGG + Intronic
1182979749 22:34657683-34657705 AAGGAAATGGAAAGGGAAGCAGG - Intergenic
1183543055 22:38441023-38441045 AAGGGCATGGAAAAGGAGAGGGG + Intronic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1184958750 22:47913125-47913147 GAGGATATGGAAAAGGATTTCGG + Intergenic
950655259 3:14432520-14432542 AAGGAGATGGAAAAGGGGCTTGG + Intronic
950852231 3:16073159-16073181 AGGGACAGGGCAAAGGAGTTGGG + Intergenic
951079311 3:18432428-18432450 AATGACCTGGACAAGGATTCAGG - Intronic
951421372 3:22489754-22489776 AAAGAAAGGGAAAAGGAGTGGGG + Intergenic
952880765 3:37984899-37984921 AAGGAGTCGGAAGAGGAGTCAGG + Intergenic
954029672 3:47809738-47809760 AATGAGAGGGAACAGGAGTCAGG + Intronic
954280113 3:49571280-49571302 CAGGACAGGGAAGAGGAGCCTGG + Intronic
954382954 3:50229314-50229336 AAGGACAAAGAAAAGGAGGGAGG + Intronic
955111493 3:55954995-55955017 AAGGACATGGAAAAGCCTTCAGG + Intronic
955748959 3:62168553-62168575 AAGGACATGCAACAGGAATGTGG + Intronic
955852920 3:63240491-63240513 AAGGAAATGAAAGAGGAGACCGG + Intronic
957138252 3:76317217-76317239 AAGTACATGGAAAAATAGACTGG + Intronic
958415390 3:93867701-93867723 AAGGAAATGGAAAGTGAGGCAGG - Intergenic
958667653 3:97160985-97161007 AAGGCCATGGAGCAGGAGTGGGG + Intronic
958932585 3:100223546-100223568 AAGGTCATGGAAAAGTATCCAGG - Intergenic
960435377 3:117620037-117620059 AAGGATATGGAAAAACATTCAGG + Intergenic
960435382 3:117620092-117620114 AAGGATATGGAAAAACATTCAGG + Intergenic
961334307 3:126160997-126161019 AAGGACCTGGAGAAGGAATAAGG + Exonic
962088418 3:132217041-132217063 AGGGACATTAAAAAGAAGTCAGG + Intronic
962228909 3:133642400-133642422 AAGGGCATGGAAAAGAAGGTAGG - Intronic
962660856 3:137599125-137599147 AAGGACAAGAAAGAGGAGTGGGG - Intergenic
962852224 3:139316650-139316672 AAGTACATTGGAGAGGAGTCTGG + Intronic
964384914 3:156137277-156137299 AGGGATAAGGAAAAGGAATCAGG + Intronic
964791694 3:160459307-160459329 GAGGAAGTGGAAGAGGAGTCAGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967974407 3:195024895-195024917 AAGAACATGGAAAACAAGGCCGG - Intergenic
968610683 4:1555592-1555614 AAGGACAGGGACAGGGAGGCCGG - Intergenic
968938364 4:3625125-3625147 AAGGACAAGGAGAAGCAGTGTGG + Intergenic
969355284 4:6621348-6621370 CAGGACAGGGAAAAGCAGTGCGG + Exonic
970281784 4:14464765-14464787 AAGGACATTGAAAAAGACTTTGG + Intergenic
970602723 4:17653038-17653060 AAGAGCTTGGCAAAGGAGTCAGG - Intronic
970958533 4:21844602-21844624 ATGGACTTGGAAAAGGAAGCAGG - Intronic
971788782 4:31140434-31140456 AAGGACATGGGAAAATAATCAGG - Intronic
973264590 4:48198510-48198532 TATGACAGGGAAAAGGAGTTGGG - Intronic
976782326 4:88774830-88774852 AAGGACTTGGAAAATGACTAAGG + Intronic
978549516 4:109910370-109910392 AAGGACATAGAGAAGGAGAAGGG - Intergenic
979549603 4:121976232-121976254 AAGGGCATGGAGAGGGATTCTGG - Intergenic
980590315 4:134878783-134878805 GAGGACATGGAAATGGATTAAGG + Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
984019778 4:174471055-174471077 AGGGTAATGGAAAAGGAGTGAGG - Intergenic
984162406 4:176269824-176269846 GAGGAAATGGAAAAGAAATCAGG + Intronic
985176891 4:187211711-187211733 TAGGACATTGTCAAGGAGTCAGG + Intergenic
986346679 5:6842094-6842116 AATAACATGGAAAAAGAGTGGGG - Intergenic
989147931 5:38266911-38266933 AGGGACATGGAAAAATAGACCGG + Intronic
989227465 5:39046745-39046767 AAGGATATGGAACAGGAGGAGGG - Intronic
989785930 5:45329457-45329479 AAGGAAAAGGCACAGGAGTCTGG + Intronic
990119867 5:52437890-52437912 AAAGACATTTAAAAGGAGCCAGG - Intergenic
990267626 5:54095088-54095110 TAGGACAGGGAAAAGGATTTAGG + Intronic
992634858 5:78717640-78717662 AATGACATGGCAAAGGATGCTGG - Intronic
993083391 5:83331351-83331373 AAGTACATGAAAAAGCTGTCAGG - Intronic
994975500 5:106799311-106799333 AAAGAAATGGTAAAGGATTCCGG + Intergenic
995028712 5:107455109-107455131 AAGGCCATGGAAAAGACGTTAGG - Intronic
995369290 5:111400849-111400871 AAGTCCATGGAAAAGGGGTTTGG - Intronic
996653772 5:125914675-125914697 CAGGATGTGGAAAAGGGGTCAGG + Intergenic
996832841 5:127758824-127758846 GAGGACAAGGAAAGGGACTCTGG + Intergenic
997196953 5:131986625-131986647 AAGGACCTGGAACAGGAGTCAGG - Intronic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998613949 5:143719257-143719279 AAGGACATTGAATAGAAGGCTGG - Intergenic
999875715 5:155803528-155803550 AAGGAGTGGGAAAAGGAGCCTGG + Intergenic
1001282837 5:170400145-170400167 AAGAATATGGCATAGGAGTCAGG - Intronic
1001763802 5:174228928-174228950 AAGGATATGGAGAAAGAGCCAGG + Intronic
1002149102 5:177212132-177212154 GGTGACATGGAAAAGGAGCCAGG + Exonic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002419321 5:179137520-179137542 GAGGACATGGAAGAGGTGGCCGG - Intronic
1003081250 6:3023549-3023571 AAGGACATCTTAAAGGAGACAGG - Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004175026 6:13332233-13332255 AAGGAAATGGAGATGGAGTGAGG + Intergenic
1004176893 6:13347919-13347941 AAGGAAAGTGAAGAGGAGTCAGG + Intergenic
1004727433 6:18324986-18325008 AAGCATATGGGAAAGGAGTAGGG + Intergenic
1005518924 6:26581239-26581261 AGGGGGATGGAAAAGGAGTTTGG + Intergenic
1006295137 6:33166895-33166917 GAGGACATGGAGAGGGAGCCGGG + Intronic
1006689591 6:35870382-35870404 GAGGAAATGGAGAAAGAGTCGGG - Exonic
1007494069 6:42247205-42247227 AAGGAGATGGAAGAGTATTCTGG + Intronic
1007698185 6:43747138-43747160 GGGGACATGGAAAAGGAGGAAGG - Intergenic
1007908678 6:45490489-45490511 AAGGCAATGAAAAAGGAGACAGG + Intronic
1008109119 6:47473554-47473576 AAGGACAAGGAAGGGTAGTCAGG - Intergenic
1008456391 6:51715902-51715924 AAGGAAATTCAAATGGAGTCCGG + Intronic
1008903142 6:56645923-56645945 AATGACATAGAAAAAGAGTGGGG - Intronic
1008910364 6:56725570-56725592 ATGGACAAAGAAAAGGAGTTAGG + Intronic
1009743225 6:67775843-67775865 AAGTACTTGGGAAAGAAGTCTGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1010375933 6:75170106-75170128 AAGAAAATGGAAAAGGGGTAAGG - Intronic
1010386962 6:75291231-75291253 AATAACAGGGAAAAGGAGACAGG + Intergenic
1010827070 6:80486932-80486954 AGAGACATGGAGAAGGAGTTGGG + Intergenic
1011545503 6:88478177-88478199 AAGCACATGGGAAAGGAGTGAGG + Intergenic
1011951576 6:92973330-92973352 AAGTACTTGAAAAAGGAGACTGG + Intergenic
1012411205 6:98959584-98959606 AAGAACATGGAATAGAAGTGTGG - Intergenic
1012912272 6:105131938-105131960 AATGACAAGGAAAAAGAGGCTGG - Intronic
1013476178 6:110509195-110509217 AAGGACATGCAACAGGGGTATGG - Intergenic
1013866875 6:114709189-114709211 AAGTACATGGAGAAAGAATCAGG - Intergenic
1013939446 6:115644406-115644428 CTGGACATGCAAAAGGTGTCTGG + Intergenic
1014838319 6:126185396-126185418 CAGGACATGCAAAAGAAGCCTGG - Intergenic
1015714300 6:136175042-136175064 AGGGAAATGGGAAAGGACTCTGG + Intronic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1017373173 6:153736473-153736495 AAGGGCATGGAAATGGAATCTGG - Intergenic
1017943367 6:159073252-159073274 AAGAACATAGAAAAGGGGTGAGG - Intergenic
1018216598 6:161534117-161534139 CAGGACAGGGAAAGGGAGTCTGG - Intronic
1019754787 7:2761042-2761064 AATGACATGTAAACGGAGTCAGG + Intronic
1021918843 7:25463255-25463277 AAGGACATAGCAAAGAAGACTGG + Intergenic
1022398867 7:30016688-30016710 AATGAAATGAAAATGGAGTCCGG - Intronic
1022675612 7:32495937-32495959 GAGGAGCTGCAAAAGGAGTCAGG - Intronic
1022684927 7:32587851-32587873 AAGGACAAAGAAAAGGAATGTGG + Exonic
1023333155 7:39140559-39140581 TAGGTCATGGAAAAAGAGACTGG - Intronic
1024215675 7:47246256-47246278 AAGTACAGGGAAGAGGAGGCAGG + Intergenic
1024519475 7:50292163-50292185 AAGGTCCAGGAAAAGGAGTATGG - Intergenic
1024902033 7:54330300-54330322 AAGGACATTGCAAAGGATTCGGG + Intergenic
1026071378 7:67123724-67123746 AAGCACATAGAGAATGAGTCTGG + Intronic
1026137607 7:67677297-67677319 TAGGACAAAGAAAAGGAGACTGG + Intergenic
1026370568 7:69694456-69694478 AATGACATGGAAAGGAAGTCAGG + Intronic
1026514729 7:71058985-71059007 ATGGACATGGAAAAGGGATGAGG - Intergenic
1026710163 7:72730811-72730833 AAAGACATGGAAAAGTAAACAGG + Intronic
1028305512 7:89258901-89258923 AAGGAGGTGGAAGAGGAGGCAGG + Intronic
1029094309 7:98072944-98072966 AGGGAAATGGAAAAGGTATCAGG - Intergenic
1029969788 7:104777856-104777878 AGTGACATGAAAAAGGAGTGTGG + Intronic
1030350351 7:108478130-108478152 AGGAAAATGGAAAAGCAGTCAGG + Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1032018516 7:128394097-128394119 AAGGACAAGGAACAGGGGGCTGG + Intronic
1032287456 7:130551591-130551613 AAGAACATGAAATAGCAGTCTGG + Intronic
1032513697 7:132491833-132491855 AAGGAGATGGGGAAGGAGACAGG + Intronic
1032702256 7:134392582-134392604 GAGGACATGGAAAGGAAGACAGG + Intergenic
1033848027 7:145459051-145459073 AAGGAGAAGGGAAAGGAGTGAGG - Intergenic
1034187130 7:149186968-149186990 AAGGTCCTGGAAAACAAGTCAGG + Intergenic
1034409951 7:150935282-150935304 AAGGCCATAGAAATAGAGTCAGG - Intergenic
1035992336 8:4506353-4506375 GGGCTCATGGAAAAGGAGTCTGG - Intronic
1036090496 8:5660076-5660098 AAGGACATGGCAATGTACTCTGG + Intergenic
1036288225 8:7463212-7463234 AAGGATAAGAAAATGGAGTCGGG + Intronic
1036333250 8:7848316-7848338 AAGGATAAGAAAATGGAGTCGGG - Intronic
1036707599 8:11056764-11056786 CAAGACATGGAAAAGGGCTCAGG - Intronic
1037766906 8:21777759-21777781 AGGGACCTGGATAAGGAGTCGGG + Intronic
1038730857 8:30126449-30126471 GAGGACTTGGAAAAGGAGGTTGG - Intronic
1040675589 8:49745616-49745638 AAGGAAATGTAGAAGGATTCTGG + Intergenic
1040989335 8:53332794-53332816 AAGGACATGAAAAAGTTGTTAGG - Intergenic
1041899913 8:62970667-62970689 AAGGGAATGGACAAGGAGACAGG + Intronic
1043111594 8:76190843-76190865 AAGGACTTGGAAAAGACTTCAGG + Intergenic
1043746939 8:83886196-83886218 AAGGAGATGGAAAGGGAGGCAGG + Intergenic
1044138978 8:88624471-88624493 AAGGAAATGGTAAAGGAGTAGGG - Intergenic
1044171783 8:89062304-89062326 AAGGACATGAAAGGGGAGGCAGG + Intergenic
1044693967 8:94904749-94904771 GAGGGCATGAAAAAGGAGCCTGG - Intronic
1044835104 8:96288131-96288153 AAGGACATGATAAAGGATACAGG + Intronic
1045227521 8:100264089-100264111 CAGGCAATGGAAAAGGAGTTAGG - Exonic
1045265692 8:100617031-100617053 CAGCAGATGGAAAAGGGGTCTGG + Intronic
1045993251 8:108334618-108334640 AAGGAGGTGGAAAGGGAGGCAGG - Intronic
1046025144 8:108713311-108713333 AATGAGATAGAAAAGGAGACTGG + Intronic
1047630915 8:126707271-126707293 AAGGCCTTGGAAAAGGAATTGGG - Intergenic
1047759675 8:127944949-127944971 AAGGACATAGAAAAGCTTTCCGG + Intergenic
1048412918 8:134194203-134194225 AAGGACATAGAAAAGGATAGTGG + Intergenic
1049439444 8:142602519-142602541 ATGGACATGGGAAGGGACTCAGG + Intergenic
1050101815 9:2127675-2127697 AAGGAGATGGAAATGTGGTCTGG + Intronic
1052425882 9:28303844-28303866 AAGGAGATAGAAAAGGAGGCAGG + Intronic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052680542 9:31685943-31685965 AAATACATGGAAAAGGGGACTGG - Intergenic
1053483188 9:38431538-38431560 AAAGACATGAAAAAGGGGGCAGG - Intergenic
1054452851 9:65412685-65412707 AAGGACAAGGAGAAGCAGTGTGG - Intergenic
1055364274 9:75526774-75526796 AAGGACATGGGAAGGGTCTCAGG - Intergenic
1055604666 9:77956399-77956421 AAGGACATGAAAAAGGAAGCTGG - Intronic
1055662125 9:78514916-78514938 AAGGAAATGGTAAAGAAGTTAGG - Intergenic
1055874077 9:80921940-80921962 AAGATCATGGTAAAGGATTCTGG + Intergenic
1056271945 9:84955254-84955276 AAGGACATGGAGAATGAAGCTGG - Intronic
1056755151 9:89377003-89377025 CAGGACAGGGAAGAGGAGCCAGG + Exonic
1058256966 9:102778339-102778361 CAGGACATGCAACAGGAGTGTGG - Intergenic
1060490473 9:124080441-124080463 AAGGAAAAGGAAAAGAAGTTAGG + Intergenic
1060610956 9:124963946-124963968 AAGGAGATGGAAGGGGAGGCAGG + Intronic
1060869697 9:127029754-127029776 AAGGCCTTGGGAAAGGAGACTGG - Intronic
1061717750 9:132531547-132531569 AAGGAGCTGGAGAAGGAGGCAGG + Intronic
1185765646 X:2723827-2723849 AAGGTTATGAAAAAGGAGACAGG - Intronic
1186840785 X:13483076-13483098 CAGGACATGGAAAATGAGAAGGG + Intergenic
1187740397 X:22349270-22349292 AAGGACATGGGAAGGGAGCCAGG + Intergenic
1187860768 X:23680238-23680260 AAAGAAATGGACAAGGAGTTGGG - Intronic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1189997089 X:46649454-46649476 TAAGAAATGGAAAAGGAGTATGG + Intronic
1190966947 X:55309815-55309837 AAGGACATTGCAAAGGATCCTGG - Intergenic
1194696788 X:97062515-97062537 AAGGACAGGGAGATGGTGTCAGG + Intronic
1194804557 X:98311510-98311532 AAGGAAAGGTAAATGGAGTCTGG - Intergenic
1196315276 X:114214735-114214757 GAGGACATGGAATAGGATTAAGG - Intergenic
1196341163 X:114600147-114600169 AAGGAAATGGAAACAGAGACAGG + Intronic
1196765828 X:119241961-119241983 AAGGAAGTGGTAAAGGAGCCAGG - Intronic
1197330490 X:125148210-125148232 AAGGAGATTGAAAAGGAGAAAGG - Intergenic
1197471185 X:126866722-126866744 AAGGAACTGAAAAAGGAGTGGGG - Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198128634 X:133672546-133672568 AAGGACTTGGTAAACGAGTTTGG - Intronic
1198701781 X:139404962-139404984 AAGGATATGGTATTGGAGTCAGG - Intergenic
1199701898 X:150385694-150385716 AAGGAGGTGGAAGAGGAGGCAGG + Intronic
1200937071 Y:8747683-8747705 AAGGACCTGCAAAAGGCCTCAGG - Intergenic
1201453010 Y:14136342-14136364 AAAGACAAGGAAAAGGAGAAGGG - Intergenic