ID: 947702359

View in Genome Browser
Species Human (GRCh38)
Location 2:232245023-232245045
Sequence CCACATGGATAATTTCTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947702359_947702364 25 Left 947702359 2:232245023-232245045 CCTTGAAGAAATTATCCATGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 947702364 2:232245071-232245093 AGGACAAGACAGGATAAGACTGG 0: 1
1: 0
2: 10
3: 185
4: 486
947702359_947702363 15 Left 947702359 2:232245023-232245045 CCTTGAAGAAATTATCCATGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 947702363 2:232245061-232245083 AAAGTTAATGAGGACAAGACAGG 0: 1
1: 0
2: 2
3: 24
4: 236
947702359_947702366 27 Left 947702359 2:232245023-232245045 CCTTGAAGAAATTATCCATGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 947702366 2:232245073-232245095 GACAAGACAGGATAAGACTGGGG 0: 1
1: 0
2: 0
3: 19
4: 225
947702359_947702365 26 Left 947702359 2:232245023-232245045 CCTTGAAGAAATTATCCATGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 947702365 2:232245072-232245094 GGACAAGACAGGATAAGACTGGG 0: 1
1: 0
2: 0
3: 14
4: 201
947702359_947702362 5 Left 947702359 2:232245023-232245045 CCTTGAAGAAATTATCCATGTGG 0: 1
1: 0
2: 2
3: 22
4: 209
Right 947702362 2:232245051-232245073 ACTGCATAGCAAAGTTAATGAGG 0: 1
1: 0
2: 0
3: 16
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947702359 Original CRISPR CCACATGGATAATTTCTTCA AGG (reversed) Intronic
900304493 1:1997974-1997996 CCACATTGATAATTTCTTAATGG - Intronic
900988737 1:6087826-6087848 TCACATGGATTATTTTTTCCTGG + Intronic
905016159 1:34780364-34780386 CCACATGCTTTATTTCATCATGG - Intronic
906418130 1:45638836-45638858 CCAGAAGAATAATTTCTTCCCGG + Intronic
906826941 1:48992375-48992397 CCACAGGGATATTTGCTCCAGGG - Intronic
909232849 1:73114139-73114161 CCACATTTATCATTTCTACAAGG - Intergenic
910819375 1:91329390-91329412 CCGCCTGGATGATTTCTTCAAGG + Intronic
910868757 1:91812433-91812455 CTACATGCATAATTTCTTCTTGG + Intronic
911406277 1:97444267-97444289 CCAAATGAAATATTTCTTCAAGG + Intronic
912346043 1:108964043-108964065 CCACAAGCATAATTTTTTAAAGG + Intergenic
913396193 1:118375362-118375384 CCTCATGGAGAATTTCTACAAGG + Intergenic
915060519 1:153179137-153179159 CCACACATATAATTTCTTCAGGG + Intergenic
917404274 1:174686524-174686546 TGACATGGATGTTTTCTTCAAGG + Intronic
918297086 1:183167197-183167219 CCACATCTATTATTTCTTGATGG - Intergenic
919551283 1:198991435-198991457 CCATAAGCAAAATTTCTTCAAGG - Intergenic
919777295 1:201202546-201202568 CGACAGGGCTAATTCCTTCATGG + Intronic
920893669 1:210021031-210021053 CCAAATAGATAATTCCTACATGG + Exonic
921332375 1:214052227-214052249 CCACATGGAGATTTTCTTTTAGG - Intergenic
921673262 1:217949971-217949993 GCACATGGAAATTCTCTTCATGG + Intergenic
924017662 1:239744864-239744886 CCCAATGGATCATCTCTTCATGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1065615810 10:27521790-27521812 TTACATGGATAAGTTCTTTAGGG - Intronic
1068159566 10:53246599-53246621 CCACATTTATACTTTCTTAAAGG - Intergenic
1068270283 10:54715239-54715261 CCATATTGGTAATTTCTTAATGG - Intronic
1069158949 10:65066663-65066685 CTATATGGAAAATTTCTACATGG - Intergenic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1073739886 10:106394342-106394364 CCACATTGATGATTAGTTCAAGG + Intergenic
1073906438 10:108285943-108285965 CCACATGCATAGATTCTACAGGG - Intergenic
1075606906 10:123818253-123818275 CCCCATGGCTACTTTGTTCACGG - Intronic
1078716955 11:13849242-13849264 CCACATTGCTAATTTCTTAAAGG + Intergenic
1078824342 11:14914059-14914081 CCAAATGGATGATTTCTCTAAGG - Intronic
1079313705 11:19389829-19389851 CCACATTGCTAAGCTCTTCATGG + Intronic
1079804336 11:24910713-24910735 CCACATGGATAACCTCTTCTAGG + Intronic
1080055407 11:27901490-27901512 CCCCATGTATAATTTATGCATGG - Intergenic
1081439386 11:43063706-43063728 CCAGATGGAAAATTTCTTTGGGG - Intergenic
1081846093 11:46241496-46241518 CCACCTGGCTCCTTTCTTCATGG + Intergenic
1082132040 11:48502448-48502470 CCACAAAATTAATTTCTTCATGG - Intergenic
1082244756 11:49909008-49909030 CCACAAAATTAATTTCTTCATGG + Intergenic
1083313179 11:61796375-61796397 CCGCCTGGATGATTTCTTCAAGG + Exonic
1084508041 11:69582189-69582211 TCAAATGGATATTTTCATCATGG + Intergenic
1085073218 11:73567438-73567460 CCACATTGAGAATTTCTTTGAGG - Intronic
1088096919 11:106111925-106111947 CCACATGAATATTGTCCTCAAGG - Intergenic
1088517801 11:110657524-110657546 CTACTTAGATAATTACTTCAAGG - Intronic
1088581064 11:111317408-111317430 TTACATGTATAAGTTCTTCAGGG - Intergenic
1089977971 11:122748976-122748998 CTACATGGAGAATGTTTTCATGG + Intronic
1094397596 12:30024884-30024906 CCTCATGGAGAATTTCTGCTAGG - Intergenic
1094597861 12:31881625-31881647 AAACATGGAAAATTTCTGCAAGG - Intergenic
1095871175 12:47029927-47029949 CCACATGGTTAGTTTCTTCATGG + Intergenic
1096829782 12:54305024-54305046 CCCCAGGGATTATTTCTTCTGGG - Intronic
1099391922 12:82092041-82092063 TCACATGAATAAGTTCTTTAGGG + Intergenic
1100519710 12:95362096-95362118 CCACTTCAATAATCTCTTCATGG - Intergenic
1102180287 12:110907454-110907476 TCACATGGTTACTTTCTTCCTGG - Exonic
1103236137 12:119374313-119374335 CCTTATAGGTAATTTCTTCATGG - Intronic
1108940440 13:55946975-55946997 CCACATGCCTAATTTTTTCCTGG + Intergenic
1109100069 13:58172492-58172514 CCACAAGGAAAATTTCTACCAGG + Intergenic
1110147621 13:72211238-72211260 CCACATAGATAATACATTCATGG + Intergenic
1111858240 13:93668113-93668135 CCTCATGGAAAATTTCTCCCTGG + Intronic
1115433084 14:33343772-33343794 CTACACGGATAATTCCATCACGG - Intronic
1115588216 14:34836435-34836457 ACACATGCAGAATTTCTACAGGG + Intronic
1118081550 14:62367304-62367326 CCATATGGACAATCTCTTCTAGG - Intergenic
1119091924 14:71790849-71790871 TTACATGGATAAGTTCTTTAGGG + Intergenic
1120270671 14:82309690-82309712 CCTCATGGAGAATTTCTGCTAGG + Intergenic
1120509220 14:85393537-85393559 CCAAAGGGAGAATTTCTCCAGGG - Intergenic
1121654315 14:95584117-95584139 CCTCATGGATAACTTCTGCTAGG - Intergenic
1121953905 14:98197008-98197030 CCAAATGGAACATGTCTTCAAGG + Intergenic
1125304526 15:38294856-38294878 CCACATATATATTTTCTTCAGGG - Intronic
1128232366 15:66044400-66044422 CCACATTGTGAACTTCTTCAAGG + Intronic
1129648542 15:77461552-77461574 GAACATGGATAATTTATTCATGG + Intronic
1129715397 15:77845536-77845558 CCACATGGAGAATCTCTACTAGG + Intergenic
1129830379 15:78665700-78665722 TCACATGCATAATGTCTTCAAGG - Intronic
1131764509 15:95660714-95660736 CCACATACAGAATTTTTTCAAGG + Intergenic
1134508510 16:14827026-14827048 CAATATGGATAATATCTTCCAGG - Intronic
1134696206 16:16225791-16225813 CAATATGGATAATATCTTCCAGG - Intergenic
1134802445 16:17097736-17097758 CTACATCCATAATTTCCTCAGGG - Intergenic
1134975620 16:18568906-18568928 CAATATGGATAATATCTTCCAGG + Intergenic
1135159192 16:20078561-20078583 CCCCACGGATAATTTGCTCAAGG + Intergenic
1136313505 16:29432818-29432840 AAACATGGATCATGTCTTCATGG - Intergenic
1136326946 16:29534583-29534605 AAACATGGATCATGTCTTCATGG - Intergenic
1136441637 16:30274568-30274590 AAACATGGATCATGTCTTCATGG - Intergenic
1138756777 16:59496143-59496165 CCACATGTATAATATCCTCATGG + Intergenic
1138825645 16:60316048-60316070 CCACACAGATAATTTATCCATGG - Intergenic
1139821359 16:69723959-69723981 ACACACGGATAACCTCTTCAGGG + Intronic
1139888429 16:70228300-70228322 AAACATGGATCATGTCTTCATGG - Intergenic
1141195723 16:81859515-81859537 CCACCTGGTTTACTTCTTCACGG - Intronic
1144408157 17:14973084-14973106 ACACATGTTTAATTTCTTCTAGG - Intergenic
1146439928 17:32885052-32885074 TCCCCTGTATAATTTCTTCAGGG - Intergenic
1147339128 17:39743452-39743474 CCACCTGGATGAGGTCTTCATGG - Exonic
1148572195 17:48678829-48678851 ATACATGGATAATTACTTCCTGG + Intergenic
1150598043 17:66624303-66624325 CCACATGGACAGTTTCATCTTGG + Intronic
1153499002 18:5729377-5729399 CAACTTTAATAATTTCTTCAGGG + Intergenic
1153536376 18:6106545-6106567 CCATCTGGATAATTTCTTATGGG + Intronic
1155708236 18:28843100-28843122 TTACATGGATAAATTCTTCAAGG + Intergenic
1157065030 18:44339677-44339699 TTACATGGATAATTTCTTTATGG + Intergenic
1158407182 18:57170222-57170244 CCTCCTGGATGATTTCCTCAAGG - Intergenic
1159287054 18:66367723-66367745 CCACAGGCAGAATTTCTTCTGGG + Intergenic
1159981899 18:74791782-74791804 CTAGATGGTTAATTTCTTGAGGG + Intronic
1163775554 19:19215253-19215275 CCTCAGGGATAATTTCTTATGGG + Intronic
1164221108 19:23194688-23194710 CTAGATGGATATTTTATTCATGG - Intergenic
1164912739 19:32025896-32025918 CCACATGGGTCATTTCTTCCAGG + Intergenic
1166173979 19:41052435-41052457 TCACTTGGTTAATCTCTTCATGG + Intergenic
1168289627 19:55351308-55351330 CCACATGGTTAGTAGCTTCAGGG + Intronic
925755623 2:7128950-7128972 TTACATGTCTAATTTCTTCATGG - Intergenic
926866500 2:17365071-17365093 CTACATGGGTAATTTCTTTAGGG + Intergenic
927162311 2:20277903-20277925 CTACATGGATAAATACTTCCTGG + Intronic
927933169 2:27058706-27058728 CCAAATGGCAAATATCTTCAGGG + Intronic
930678024 2:54225182-54225204 CCAGATAGAGAATTTCTTGAGGG - Intronic
931154683 2:59614858-59614880 CCTCATGGAGAACTTCTTCTAGG - Intergenic
932556646 2:72830356-72830378 CCACATGGACAATCCATTCATGG + Intergenic
933199534 2:79433307-79433329 CCACATGGACAATTCACTCATGG + Intronic
933417429 2:82004216-82004238 CCTCATTTATAATCTCTTCAAGG + Intergenic
934902916 2:98175179-98175201 CCTCATGGACAATTCCCTCATGG - Intronic
943585612 2:189735668-189735690 CCACATTGATACTGTCTACATGG + Intronic
944846690 2:203675804-203675826 CAAGATGCATAATTTCTACAGGG + Intergenic
944919810 2:204401031-204401053 CCACATTGGTGATGTCTTCAGGG - Intergenic
945157491 2:206854993-206855015 TCACTTGGATAATGTCTCCAAGG - Intergenic
945269488 2:207924204-207924226 CCACATGGATATATTTTTCAGGG + Intronic
947105915 2:226667746-226667768 CCGCAGGGCTAACTTCTTCAAGG + Intergenic
947702359 2:232245023-232245045 CCACATGGATAATTTCTTCAAGG - Intronic
948009073 2:234636432-234636454 CAACGGGGAAAATTTCTTCAGGG + Intergenic
1169632562 20:7649169-7649191 CCACATGGAGCTTTTATTCAAGG - Intergenic
1170643862 20:18179358-18179380 CCTCATGGATAATCTCTGCTAGG - Intronic
1171328210 20:24314605-24314627 CCAGATGGGGACTTTCTTCATGG - Intergenic
1171983903 20:31646024-31646046 TCACATGGTTAATTCCTTCTTGG - Intergenic
1172799667 20:37567012-37567034 CCACAAGCATCACTTCTTCAGGG + Intergenic
1173532070 20:43777553-43777575 CCACAGGCATGACTTCTTCAAGG - Intergenic
1173989837 20:47293459-47293481 CCACATGCAGATTTTCCTCAAGG + Intronic
1176661494 21:9639118-9639140 TAACATGTATAATTCCTTCATGG + Intergenic
1178099570 21:29253114-29253136 CCACATGGAGAATCTCTGCCAGG - Intronic
1179558547 21:42196200-42196222 CCAGATGAATAAGTTCTTAAAGG + Intergenic
1179912519 21:44457644-44457666 CCACTGGGATAATTTCCTGATGG - Exonic
1182756638 22:32685255-32685277 CTACCTGGAAAACTTCTTCAAGG + Intronic
1183696626 22:39427346-39427368 CCACATGCCTAATCTCTTCCAGG - Intronic
949821372 3:8119683-8119705 CCAAATGAATAATTTCTTGATGG + Intergenic
950953108 3:17022365-17022387 GCTCCTGTATAATTTCTTCAAGG + Intronic
951037681 3:17951652-17951674 CCTCATGGAGAACTTCTTCTAGG + Intronic
951119892 3:18914383-18914405 CCACCTGGATAATATATTCTTGG + Intergenic
951532265 3:23709221-23709243 CCACTTGGATATTTTCATGATGG - Intergenic
954473701 3:50723073-50723095 TCAGATGGAGAATTTCATCAGGG + Intronic
955127888 3:56132482-56132504 CAGCAATGATAATTTCTTCAGGG - Intronic
956438032 3:69253515-69253537 CCATATGGATCAGTACTTCATGG + Intronic
956474975 3:69610143-69610165 CCTCATGGATAATATCTGCTAGG + Intergenic
957085756 3:75675157-75675179 GCACATGGTTCTTTTCTTCAAGG + Intergenic
957468968 3:80633293-80633315 CTCCATGGATAATTACTTGAAGG - Intergenic
957509381 3:81167930-81167952 TCCCATGGCTGATTTCTTCACGG + Intergenic
958554135 3:95652093-95652115 GCACTTGGATAATTTTTTAAAGG - Intergenic
961663647 3:128483521-128483543 CCACAAGGAAAAGTACTTCATGG + Intronic
963124807 3:141805698-141805720 TTTCATGGATAATTTCTACATGG - Intronic
969985306 4:11203037-11203059 CCACATGGTTAGTTTTTTGAGGG - Intergenic
970091648 4:12415142-12415164 ATACATGGATCCTTTCTTCAAGG - Intergenic
970136100 4:12925815-12925837 TCAAATAGATAATTTCTTGACGG - Intergenic
970879499 4:20911893-20911915 CCACATGGACAATTATTTGAAGG - Intronic
971868937 4:32210483-32210505 CCCCATGGATTAATTCTACAGGG + Intergenic
972652738 4:41034768-41034790 TTACATGGAAAATTTCTTAAAGG + Intronic
975957911 4:79864407-79864429 CCACTTGGATTGTTTATTCAAGG - Intergenic
975982490 4:80176457-80176479 CACCATGGAAACTTTCTTCATGG + Intergenic
978983693 4:114983117-114983139 CCTCATGGAGAATTTCTACCAGG + Intronic
979617095 4:122755454-122755476 CCACATGCAGAATTTGCTCATGG - Intergenic
980264028 4:130492511-130492533 CCTCATGGATAATCTCTACTAGG + Intergenic
981201498 4:141984545-141984567 CCACATTGAAAATGACTTCATGG + Intergenic
981689049 4:147486050-147486072 CCACATAGATAAGGTCTCCAAGG - Exonic
984775865 4:183481367-183481389 CCACATGGACATTTTTCTCATGG + Intergenic
984987833 4:185348695-185348717 CCACATTTATCATTTCTTCGTGG + Intronic
985444257 4:190012368-190012390 GCACATGGTTCTTTTCTTCAAGG - Intergenic
986961214 5:13215278-13215300 CTCCCTGGATAATTTCCTCAAGG + Intergenic
988426832 5:31074227-31074249 CCTCATGGAGAACTTCTTCTAGG - Intergenic
990288218 5:54322135-54322157 CAATATAGGTAATTTCTTCAAGG + Intergenic
991646817 5:68808495-68808517 TTACATGGATAAGTTCTTTAGGG - Intergenic
992591562 5:78301102-78301124 CCTCATGGAGAATTTCTGCTAGG + Intergenic
994514573 5:100754440-100754462 CCACATGGACAATTTTTTTGAGG + Intergenic
994628167 5:102247583-102247605 CCACTTGCTTAATTTCTTAAGGG - Intronic
994686109 5:102954199-102954221 TTACATGGATAAGTTCTTTAGGG + Intronic
1001058179 5:168466258-168466280 CCATATTGTTTATTTCTTCATGG - Intronic
1002778188 6:346592-346614 TAACATGGCTAATTTGTTCAGGG + Intronic
1002806385 6:579395-579417 CCAATTGGAAAATTTGTTCACGG - Intronic
1002960768 6:1913078-1913100 CCACATGCAAACTTTCTTAAAGG - Intronic
1007937790 6:45749023-45749045 CCACATGGATTCTTTTTTCCAGG + Intergenic
1009278636 6:61718783-61718805 CCTTATGGATACTATCTTCAGGG + Intronic
1009901672 6:69814765-69814787 CCACATGCATACTTTCTAGATGG + Intergenic
1010330942 6:74623512-74623534 CCTCATGGATAACTTCTGCTAGG + Intergenic
1010737171 6:79456044-79456066 CAAAATGGATAATAACTTCAAGG - Intergenic
1010873818 6:81075962-81075984 GCACATGCATAATTATTTCATGG - Intergenic
1015566395 6:134576024-134576046 CCACATGCATAACATCTTCCTGG - Intergenic
1015759770 6:136645598-136645620 ACACATGCAGACTTTCTTCAAGG + Intronic
1019993328 7:4707471-4707493 CCAAATGGATAATTTCGCCTTGG + Intronic
1020726679 7:11823652-11823674 AGACATGTATAATCTCTTCAAGG - Intronic
1021004366 7:15374924-15374946 GCCCTTGGATAATTTCTTCAGGG - Intronic
1021954691 7:25812672-25812694 CAACCTGGATAATTTCCTCCTGG + Intergenic
1022283117 7:28930378-28930400 CAACATTGCTGATTTCTTCAGGG + Intergenic
1022317190 7:29256619-29256641 GCTCATGGATCATTTGTTCAAGG + Intronic
1023808071 7:43889098-43889120 CCACATGGATAATAAATACATGG + Intronic
1027943388 7:84714060-84714082 CTACATGAATCATTTATTCATGG - Intergenic
1028426129 7:90691411-90691433 CCTCATGGGTCACTTCTTCATGG - Intronic
1030459072 7:109808175-109808197 CCTCATGGATAATCTCTGCTAGG + Intergenic
1030538031 7:110793121-110793143 TCAGCTGGATAAGTTCTTCAGGG - Intronic
1033656200 7:143376321-143376343 CCAGATGGAGAGTTTCTTGAGGG + Intergenic
1034718348 7:153264341-153264363 CCACATGGAGAATCTCTGCTAGG - Intergenic
1039672272 8:39614689-39614711 CCAACTGTATAATTTCTTCAAGG + Intronic
1042161858 8:65904846-65904868 CCTCATGGAGAATCTCTTCTAGG + Intergenic
1043024982 8:75055230-75055252 CCAAATAGATAATTTTTCCATGG - Intergenic
1044125285 8:88452138-88452160 CCTCATGGAGAATTTCTGCTAGG - Intergenic
1044130313 8:88515119-88515141 ACAAATGGATAATTTGTTAATGG + Intergenic
1044233905 8:89808812-89808834 CAACATGGAAAATATCTCCAGGG + Intergenic
1044462691 8:92464395-92464417 TTACATGGATAAGTTCTTCAGGG - Intergenic
1044823429 8:96174675-96174697 TCACATGGGTAACTTCATCATGG + Intergenic
1044883286 8:96746594-96746616 CCACAAGCATTATTTCTTCCCGG + Intronic
1045561836 8:103271549-103271571 CCTCATGGATAACCTCTTCTAGG + Intergenic
1045756908 8:105554520-105554542 CCATATTTATATTTTCTTCATGG - Intronic
1045808858 8:106198339-106198361 CCACCTGCATAATTTCTTTTTGG + Intergenic
1045859613 8:106801110-106801132 CAACCTGGAAAACTTCTTCATGG + Intergenic
1046916756 8:119685852-119685874 ATACATGGACAATTTCTTGAAGG - Intergenic
1051916384 9:22213175-22213197 CACAGTGGATAATTTCTTCAGGG - Intergenic
1052394319 9:27920317-27920339 CCATATGCAGAATTTCGTCATGG - Intergenic
1054987585 9:71280366-71280388 CCACATGGAAAATTTCCCAATGG + Intronic
1055174390 9:73299488-73299510 CCTCATGGAGAATTTCTGCTAGG - Intergenic
1055264137 9:74476006-74476028 CCTCATGGAGAACTTCTTCTAGG + Intergenic
1055980932 9:81999740-81999762 CCCCTTGGATCAGTTCTTCAGGG + Intergenic
1058052858 9:100423951-100423973 TCACATGGATGAGTTCTTTATGG + Intergenic
1058223025 9:102326005-102326027 CCTCATGGATAACTTCTGCTAGG + Intergenic
1203639059 Un_KI270750v1:140961-140983 TAACATGTATAATTCCTTCATGG + Intergenic
1186224339 X:7381399-7381421 CAACACGGATAGTTTCTTAAAGG + Intergenic
1186608474 X:11115227-11115249 CCAAATGAATATTTTCTTCTGGG + Intronic
1188214114 X:27457561-27457583 ACACTTAGATAACTTCTTCATGG + Intergenic
1190003684 X:46713670-46713692 CCTCATGGATATTCTCTTCTGGG - Intronic
1190125468 X:47701172-47701194 CCACAGGGCTAATCTCTTAAGGG - Intergenic
1190624934 X:52327965-52327987 ACACATTGGAAATTTCTTCAGGG - Intergenic
1193485209 X:82078729-82078751 CCTCATGGAGAATCTCTGCAAGG - Intergenic
1193964176 X:87963738-87963760 GCACATGGAACATTTCTCCAAGG + Intergenic
1194606128 X:95980801-95980823 CTACATGAATAAGTTCTTTAGGG + Intergenic
1194673738 X:96768476-96768498 CCATACAGATAATGTCTTCATGG + Intronic
1197762119 X:130035453-130035475 CCATATGGATTATTTCCTCAGGG + Intronic
1198113297 X:133521833-133521855 ACACATGGAGAGTTACTTCAAGG - Intergenic
1198401466 X:136272598-136272620 CCAAATGCATAATTTCAACAGGG - Intergenic
1199560851 X:149161170-149161192 CCACAAGGATAAATGCTTGAAGG + Intergenic
1199840860 X:151646891-151646913 CTACCTGGTTAATTTCTTCAAGG - Intronic