ID: 947702789

View in Genome Browser
Species Human (GRCh38)
Location 2:232249181-232249203
Sequence TGGGCTTCTCCTAAGCGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947702784_947702789 -7 Left 947702784 2:232249165-232249187 CCAAAACTCTGCCCACTGGGCTT 0: 1
1: 0
2: 1
3: 28
4: 296
Right 947702789 2:232249181-232249203 TGGGCTTCTCCTAAGCGGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947702789 Original CRISPR TGGGCTTCTCCTAAGCGGGT TGG Intronic
900078631 1:837925-837947 TGTGCTTGTCCTCAGAGGGTGGG + Intergenic
909314428 1:74197937-74197959 TCGCCTTATCCTTAGCGGGTCGG + Intronic
912208789 1:107535999-107536021 TGGGCTTCTGCTCAGGAGGTGGG - Intergenic
916530761 1:165654031-165654053 TGGCCTTCTCCTAGACAGGTGGG - Intronic
1068135357 10:52947602-52947624 TGGACCTCTCCTATGCGTGTTGG - Intergenic
1069682364 10:70294364-70294386 GGGGCTTTTCCTAAGTGGGGTGG - Intergenic
1073117250 10:101098207-101098229 TGCGCTTCTCCTTAGTGGGAAGG + Intronic
1084418511 11:69048805-69048827 TGGGGTTCTCCTGAGTGGGGCGG - Intergenic
1094659516 12:32453648-32453670 TAGGCTTCTTCTAAGCAAGTTGG - Intronic
1101036546 12:100713183-100713205 TGGCCTTCTCCAATGTGGGTAGG - Intergenic
1105549292 13:21377757-21377779 TGGGCTTGTCCTCAGCAGTTAGG - Intronic
1110150758 13:72250417-72250439 TGGGCAGCTCCTAGGTGGGTGGG - Intergenic
1116386452 14:44336636-44336658 TGGGTTTCTCCTATGGGTGTGGG - Intergenic
1119476625 14:74934277-74934299 TAGTCTTTTCCTAAGAGGGTGGG + Intergenic
1120889255 14:89477177-89477199 TGGGCTTAGTCTAAGGGGGTGGG - Intronic
1125180639 15:36878500-36878522 TGTGCTCCTCCTCAGCCGGTGGG + Intergenic
1129217382 15:74108013-74108035 TGGCTTTCTCCTAAGAGGGCAGG - Intronic
1131003289 15:88955278-88955300 CGTGCCTCTCCTAAGCGGGGAGG - Intergenic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1134166044 16:11930408-11930430 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134494675 16:14723319-14723341 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134500058 16:14762439-14762461 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134526599 16:14949057-14949079 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134545803 16:15107288-15107310 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134580522 16:15366611-15366633 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134714177 16:16347530-16347552 TGGGCGTTTCCCAAGAGGGTGGG - Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134722051 16:16390894-16390916 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1134945376 16:18320975-18320997 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134952640 16:18361128-18361150 TGGGCGTTTCCCAAGAGGGTGGG + Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1135311434 16:21407833-21407855 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1135364386 16:21840284-21840306 TGGGCGTTTCCCAAGAGGGTGGG + Intronic
1135447457 16:22531064-22531086 TGGGCGTTTCCCAAGAGGGTGGG - Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1140347822 16:74232020-74232042 TGGGTTTTTCTGAAGCGGGTTGG - Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142571983 17:880720-880742 TGGCCTTCTCCTAAGGGGGCAGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147864008 17:43541187-43541209 TGGCCTTCTCCCAAAGGGGTAGG + Intronic
1154117305 18:11622453-11622475 TGGGCGTTTCCCAAGAGGGTGGG + Intergenic
1155150155 18:23116718-23116740 CAGGCTTCTTCTAAGCTGGTGGG + Intergenic
1157583003 18:48784109-48784131 TGGGCATCTCCTAATCTGGTGGG + Intronic
1157692521 18:49695210-49695232 TGGGCTTCTCCTAGGCTGCCAGG + Intergenic
1165059800 19:33199601-33199623 TGCTCTTCTCCAAAGCGGGTTGG - Intronic
1165418713 19:35711731-35711753 TAGGCTTCTCTTAAGGGGGAAGG - Intronic
947702789 2:232249181-232249203 TGGGCTTCTCCTAAGCGGGTTGG + Intronic
948468041 2:238161533-238161555 TGGGCTCCTACCAAGCAGGTGGG - Intronic
1172155384 20:32820252-32820274 TGGGCTGCTGCTACGCGGGGTGG + Intronic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
949638333 3:6008713-6008735 TGGGCTGGACCTAATCGGGTAGG + Intergenic
954435423 3:50493389-50493411 TGGGTTTCTCTTAAGAGGGGAGG - Intronic
954617346 3:51976049-51976071 CGCGCTTCTCCAAAGCGGGAAGG - Intronic
956061760 3:65355420-65355442 TGGGCTTCTACTAAAAGGGAGGG + Intronic
968493757 4:904149-904171 TGGGCGGCTCCTAACCGAGTGGG + Intronic
968493856 4:904567-904589 TGGGCGGCTCCTAACCGAGTGGG + Intronic
971159136 4:24115407-24115429 TGGGATTTTCCTAAGCATGTAGG - Intergenic
975721410 4:77252046-77252068 TGTGCTTATTCTAAGCAGGTTGG + Intronic
984562557 4:181287875-181287897 AGGGTTTCTCCTAAGAGGGAGGG - Intergenic
986090851 5:4503447-4503469 TGAGCTTGTGCTAAGTGGGTGGG - Intergenic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
998292396 5:140927523-140927545 TGTGCGTCTCCTGAGCGGGCAGG - Exonic
1001661780 5:173398753-173398775 TGTGCTTCTCCTAAGTGAGCTGG - Intergenic
1019039409 6:169091154-169091176 TGGGCCACTCCTTAACGGGTTGG - Intergenic
1029126462 7:98298136-98298158 GGGGCTTCTCCCAAGGGGGCAGG - Intronic
1029492860 7:100881814-100881836 GGGGCTTCTCAGAAGAGGGTTGG + Intronic
1035004525 7:155644988-155645010 TCGTCCTCTCCTAAGCGGGGAGG - Intronic
1035527013 8:321820-321842 TGTGCTTGTCCTCAGAGGGTGGG - Intergenic
1039506694 8:38057371-38057393 TGAGCTGCTCCTTAGAGGGTAGG - Intronic
1041560752 8:59215453-59215475 TGGGCTGCTCCTAAAAGGGGTGG - Intergenic
1041769136 8:61454150-61454172 TGGACTCCTCCAAAGCGGGCAGG - Exonic
1049268964 8:141684124-141684146 TGGGCTTCCCCAAGGAGGGTGGG - Intergenic
1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG + Intronic
1057748803 9:97773386-97773408 AGTGCTGCTCCTAAGCGTGTAGG + Intergenic
1059334374 9:113559509-113559531 TGGGCTTCTCCTTGCTGGGTTGG + Intronic
1187452591 X:19411928-19411950 GAGGCTTCTCATAAGAGGGTAGG + Intronic
1195049170 X:101080957-101080979 TGAGCTCCTGCTAAGCTGGTAGG - Intronic
1200116825 X:153773145-153773167 AGGGCTTCTCCTACGGGGGTTGG + Intronic