ID: 947705055

View in Genome Browser
Species Human (GRCh38)
Location 2:232267922-232267944
Sequence TTCCCAAGACACTTTCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947705055_947705057 18 Left 947705055 2:232267922-232267944 CCATTATGAAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 22
4: 207
Right 947705057 2:232267963-232267985 AAGCTACACCTACTGCCTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 117
947705055_947705056 -5 Left 947705055 2:232267922-232267944 CCATTATGAAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 22
4: 207
Right 947705056 2:232267940-232267962 GGGAATATTGATTGATTTTTAGG 0: 1
1: 0
2: 1
3: 23
4: 311
947705055_947705059 20 Left 947705055 2:232267922-232267944 CCATTATGAAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 22
4: 207
Right 947705059 2:232267965-232267987 GCTACACCTACTGCCTGCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 126
947705055_947705058 19 Left 947705055 2:232267922-232267944 CCATTATGAAAGTGTCTTGGGAA 0: 1
1: 0
2: 1
3: 22
4: 207
Right 947705058 2:232267964-232267986 AGCTACACCTACTGCCTGCTGGG 0: 1
1: 0
2: 1
3: 6
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947705055 Original CRISPR TTCCCAAGACACTTTCATAA TGG (reversed) Intronic
901127374 1:6939040-6939062 TTCCCAAGCCACATTCATGCTGG - Intronic
902886552 1:19408820-19408842 TTGCCAAGGCACCTTCTTAATGG + Intronic
903075004 1:20757725-20757747 TTCCAAAGACACCTTCTTCAAGG + Intronic
905943458 1:41882809-41882831 TTAGCAAGACACTTTCCAAATGG - Intronic
906458455 1:46018827-46018849 TACCCAAGAGACTCTCATATAGG + Intronic
908974446 1:69880581-69880603 CTCCCATGATATTTTCATAAAGG - Intronic
910062853 1:83114316-83114338 TTCCAAAGACCCTTTCAGAAGGG - Intergenic
911103650 1:94113313-94113335 TTAGCATGAGACTTTCATAAAGG + Intronic
911246435 1:95523442-95523464 TTCCTAAGCCTCTTTTATAAGGG - Intergenic
911906502 1:103575514-103575536 TGGCCAAGACAGTTTCAAAATGG + Exonic
911910011 1:103621867-103621889 TGGCCAAGACAGTTTCAAAATGG + Exonic
911917427 1:103715992-103716014 TGGCCAAGACAGTTTCAAAATGG + Intronic
912620176 1:111147911-111147933 TTCCCAATACCCTTGCATTAAGG - Exonic
913495664 1:119426124-119426146 TTCCCACTATAATTTCATAAGGG + Intergenic
914317379 1:146526590-146526612 ATCCCTAGAAACTTTCAGAAAGG + Intergenic
914496977 1:148206770-148206792 ATCCCTAGAAACTTTCAGAAAGG - Intergenic
915606175 1:156952722-156952744 TTCCCTAGCCACTTGCCTAAAGG - Intronic
920169693 1:204063941-204063963 TCCTCAAGCCTCTTTCATAAAGG + Intergenic
920624949 1:207587812-207587834 TGCCCAAGATATTTTGATAAAGG + Intronic
921720543 1:218465831-218465853 TTCCCAAGAAACTTAGACAAGGG + Intergenic
922413059 1:225394340-225394362 TTTCCAAATCACTTTCTTAATGG + Intronic
923356931 1:233166429-233166451 TTCGAAAGACACTTACAAAAAGG + Intronic
923958845 1:239054373-239054395 TTCCCAAGACTTTTTGATCATGG + Intergenic
1063331270 10:5161809-5161831 TGCCCAAGACTGTTTCATCATGG - Intergenic
1064144202 10:12814636-12814658 CTCTCAAGTCACTTTGATAAGGG + Intronic
1065420999 10:25543988-25544010 TTCCCAAGAGGCATTCTTAAAGG + Intronic
1065754187 10:28915884-28915906 TTTCCAAGTCACTTTTATACAGG + Intergenic
1067975768 10:51023374-51023396 TTCCCAATGCTCTTACATAAGGG - Intronic
1068287235 10:54954770-54954792 GTCCCAACAAACTTTAATAAAGG - Intronic
1070463143 10:76689879-76689901 TTCTCAAAACACTTTCCTACCGG + Intergenic
1071989766 10:91089956-91089978 TTCCAAAGACAATTTCAGAGTGG + Intergenic
1076031816 10:127165853-127165875 TTCCCAATACACTTTATTTATGG + Intronic
1076103643 10:127803007-127803029 CTCAGAACACACTTTCATAATGG + Intergenic
1079993839 11:27274597-27274619 TCCCCAAGACAGCATCATAACGG + Intergenic
1080403715 11:31959794-31959816 CTCCCTAGACACGTTCATAGTGG - Intronic
1082005339 11:47415960-47415982 TTCCTAAGACCCTTTCCTCAGGG + Exonic
1082983942 11:59150494-59150516 TTCCCAAGTCATATTCATCATGG - Intronic
1084391446 11:68879897-68879919 TTCTCACGACACTCTCCTAACGG + Intergenic
1085828993 11:79879528-79879550 GTCTCAAGACACTTCTATAATGG - Intergenic
1086070523 11:82794535-82794557 TGCCCAATACACTTTTAGAAAGG + Intergenic
1087855078 11:103082270-103082292 TTGCCAAGTGAATTTCATAAAGG - Intronic
1088083088 11:105944173-105944195 TTCCCTGCACATTTTCATAATGG + Intronic
1088903595 11:114137364-114137386 TTCCCAAGACACTTCCATTTTGG - Intronic
1089190655 11:116650960-116650982 TTCCAAAGACCCTTCCAAAAAGG - Intergenic
1090687763 11:129142626-129142648 CACCCAATACACATTCATAAAGG + Intronic
1092231934 12:6780833-6780855 TTCCCCATGCTCTTTCATAAAGG + Intergenic
1092802160 12:12179767-12179789 TTTTCAAGCCACTTTTATAATGG - Intronic
1095361347 12:41344285-41344307 TTCCTAAGACACTTTTAAAATGG - Intronic
1097297373 12:57981249-57981271 TTCCCAATATATTATCATAAAGG - Intergenic
1097730164 12:63120026-63120048 TTCCAAAGGCTATTTCATAAAGG + Intergenic
1097780840 12:63702814-63702836 TTCCTCAGGCTCTTTCATAAGGG - Intergenic
1098087305 12:66860402-66860424 GTCTCAACACACTTTCAAAAAGG - Intergenic
1098647295 12:72919412-72919434 TTCCTAAGACACTTGCAGTATGG + Intergenic
1098659887 12:73078895-73078917 TTCCCAACACAATTTATTAAAGG - Intergenic
1102237786 12:111305104-111305126 TTGACAAGAGACTTTCATCAAGG + Intronic
1104379503 12:128294726-128294748 CTCCCTAGACCCTTTTATAAGGG + Intronic
1105565977 13:21548711-21548733 ATCCCAAGACACCTTCACATAGG + Intronic
1106854471 13:33834360-33834382 TTCCAAATACACATTCTTAAAGG - Intronic
1106999358 13:35525867-35525889 TTCCCAAGCCTCTTCTATAAGGG + Intronic
1107424123 13:40275937-40275959 TTCCCAAGCTACTTTCAGAGAGG - Intergenic
1107535999 13:41333181-41333203 TCCACAAGACACTTTTATTAGGG - Intronic
1108472486 13:50781486-50781508 ATCCCTAGACACTTTGAAAACGG + Intronic
1109207564 13:59499087-59499109 TTCCTAAGACAATGACATAAAGG - Intergenic
1109700097 13:66013136-66013158 TTCCCAACACTGTTTAATAAAGG - Intergenic
1109950211 13:69491920-69491942 TTCCAAAGACATTTTTATCATGG + Intergenic
1110157379 13:72334325-72334347 TGCCCAAGCCACTGTCCTAAGGG - Intergenic
1110806868 13:79765094-79765116 TTCCCAGGAAACTTTGATGAGGG - Intergenic
1111184109 13:84708292-84708314 TTCTCACAACACTCTCATAAAGG + Intergenic
1111538739 13:89641697-89641719 TTCCCAAGAACCTATAATAAAGG + Intergenic
1111604812 13:90523523-90523545 TTTTCAAGATACTTTCAGAATGG - Intergenic
1111966693 13:94868730-94868752 TTCCAAATACACTTACATTAGGG - Intergenic
1112336869 13:98523411-98523433 TGCCCAAGTCACATTCATAGGGG - Intronic
1112757369 13:102652631-102652653 TTCAGAAGACATTTTAATAAAGG - Intronic
1115179898 14:30611485-30611507 TGTGCAAGACACTTTCATACAGG - Intronic
1116655087 14:47642293-47642315 TTCCCAAGGCACTTAGAAAAGGG + Intronic
1119312901 14:73665094-73665116 TTCCCAAGTAACTATAATAATGG - Intronic
1120488634 14:85148038-85148060 TTCCAAAGACACCCTCACAAAGG - Intergenic
1126984216 15:54284435-54284457 CTCCCAGGACACTTTCACACAGG + Intronic
1127695318 15:61441179-61441201 TTTCCAAGAAAATTTCACAAAGG - Intergenic
1130121748 15:81055667-81055689 TTCCAAAGACAATATCAAAAAGG - Intronic
1130819936 15:87484385-87484407 TTCCCAATCCACTTTTAGAAGGG - Intergenic
1131886471 15:96920107-96920129 TTCAAAAGACACTATCAAAAAGG - Intergenic
1135223375 16:20634262-20634284 TTACCAAACCACTTTCACAATGG - Intronic
1139889358 16:70238464-70238486 TTCCCTAGAAACATTCATACAGG - Intergenic
1140845941 16:78888251-78888273 TTCTCAAGTCACTTTCAGAAGGG - Intronic
1144141593 17:12354744-12354766 TCCCCAAAACATTTTTATAATGG + Intergenic
1144154705 17:12488105-12488127 TTCCCAGGAGATTCTCATAAAGG - Intergenic
1145444207 17:23150163-23150185 TTCCAAAGACACCTTCAAAGAGG - Intergenic
1145444555 17:23154923-23154945 TTCCAAAGACATTTTCAAAGAGG - Intergenic
1146733525 17:35216336-35216358 TTACCTAAAAACTTTCATAAAGG + Intergenic
1154550819 18:15679194-15679216 TCCAAAAGACACTTTCAAAACGG - Intergenic
1155340681 18:24811399-24811421 ATTCCAAAACATTTTCATAAAGG + Intergenic
1155714990 18:28931027-28931049 ATCCCAAGACATTTACAAAATGG - Intergenic
1156082512 18:33355271-33355293 TTCCAAACACTCTTTCATAATGG + Intronic
1156573489 18:38285070-38285092 TTCCCCAGACCTTGTCATAAAGG - Intergenic
1157113311 18:44841382-44841404 TTTCCAAGACAAGGTCATAAAGG - Intronic
1158907335 18:62026736-62026758 TTCCCAAGACAAATTCATTCTGG - Intergenic
1166192638 19:41185410-41185432 TTCTCAAAAAACTATCATAAGGG + Intergenic
1167200309 19:48060689-48060711 ATCCCAAGACAATATGATAAAGG - Intronic
925381680 2:3431967-3431989 TTCCAAAGAAACATTCACAATGG + Intronic
926572593 2:14545624-14545646 TTCTAAAGACACTTTCCTAATGG - Intergenic
928287781 2:30008526-30008548 TCCCCAACACACTTCCATACAGG - Intergenic
929698375 2:44140011-44140033 TTCTCAAGCCTCTTTTATAAGGG + Intergenic
930320030 2:49843319-49843341 TTCCCTTGACCCTTTCATGAGGG + Intergenic
931486570 2:62699533-62699555 TACTTAAGATACTTTCATAATGG - Intronic
931706334 2:64949351-64949373 TGTTCAAGACACTTTCATATTGG + Intergenic
933452695 2:82477094-82477116 TTCTGAAGCCTCTTTCATAAGGG - Intergenic
934074105 2:88412860-88412882 CTCCAAAGACACCTTCATACTGG + Intergenic
936684920 2:114816455-114816477 CTCCCTAGACCTTTTCATAATGG + Intronic
937556212 2:123160421-123160443 TTCCCAACACACTTCCAGGAAGG - Intergenic
937998900 2:127716404-127716426 TTCGACACACACTTTCATAACGG - Intronic
939314827 2:140534687-140534709 ATGTCAAGAAACTTTCATAATGG - Intronic
940265813 2:151835590-151835612 TTGCCAAGACACATTCTTAACGG + Exonic
941685687 2:168446011-168446033 TTTCCAAGTCACTTTTACAAAGG + Intergenic
942426131 2:175862785-175862807 ATGCCAAGAAACTTTCACAAGGG - Intergenic
942561684 2:177226653-177226675 TTACCAAGACACTATCTTTAGGG - Intergenic
945169394 2:206980054-206980076 TTCCCAAATCACTTTCATTAGGG + Intergenic
945169965 2:206985487-206985509 TGTCCCAGACACTTTTATAATGG - Intergenic
946181200 2:217950246-217950268 TTCCCAAGACAATTTTTTCAAGG - Intronic
946550432 2:220795321-220795343 GTCCAAAGCCTCTTTCATAAAGG - Intergenic
946765998 2:223041630-223041652 TTCCCAGGAGACTTGCATGAAGG + Intergenic
947705055 2:232267922-232267944 TTCCCAAGACACTTTCATAATGG - Intronic
947814599 2:233027915-233027937 TTCCCCAAATTCTTTCATAAAGG + Intergenic
1170230365 20:14040032-14040054 TTCCCCAGATACTCTCCTAAAGG - Intronic
1170460413 20:16572495-16572517 TTCCAAAGAAACTTTCTAAACGG + Intronic
1171071836 20:22077171-22077193 TGCCCAAGTCACTGTCAGAATGG + Intergenic
1171350144 20:24495617-24495639 TCCCCAAGGCACTTTTCTAAGGG - Intronic
1175294879 20:57901559-57901581 TGTACAAGACACTTTCATACGGG - Intergenic
1175508877 20:59508030-59508052 TACCCAAGACACTGCCACAATGG + Intergenic
1177712628 21:24798617-24798639 ATCCCAACACATTTTCAAAAGGG - Intergenic
1179951238 21:44709841-44709863 CTCCCAAGAGACTAGCATAAGGG - Intronic
1182700954 22:32237879-32237901 TTCTCATGACACTCTCATAAAGG - Intronic
1183850838 22:40586457-40586479 CTACCAAAACACATTCATAATGG + Intronic
1183934443 22:41254234-41254256 ATCCCGAGGCACTTTCACAATGG - Intronic
1184376697 22:44117962-44117984 TTCCATAGGTACTTTCATAATGG + Intronic
1184710715 22:46247859-46247881 TTGCCATGACACTTTCTTAATGG - Intronic
1184938726 22:47744719-47744741 CTCTCAAAACACTTTTATAAAGG + Intergenic
1185007802 22:48294097-48294119 ATTCAAAGACAGTTTCATAATGG + Intergenic
1185180643 22:49359142-49359164 CTCCCAAGGCACTTTCATTCGGG + Intergenic
949211161 3:1503162-1503184 TTCAGAAGACACTTTCAAATTGG + Intergenic
949676811 3:6464018-6464040 TCCCCAAGACACTTGCAGAAGGG - Intergenic
950754191 3:15159055-15159077 TTAGCTAGACACTTTAATAAGGG - Intergenic
951093186 3:18598780-18598802 TTCCAAAGTCACTTTCATATTGG + Intergenic
951801154 3:26597229-26597251 TTCCCAAGCCAATTGCATTAGGG - Intergenic
951926731 3:27915998-27916020 TCCCAAAGACACTCCCATAAAGG + Intergenic
952265068 3:31777583-31777605 TTCCTAGTACACTTTCACAATGG - Intronic
952916764 3:38252166-38252188 TTTAAAAGACACTTTCATTAGGG + Intronic
953649375 3:44786737-44786759 TTTCCAAGAGTCTTTCAAAATGG + Intronic
954003649 3:47576875-47576897 TTCCCAAGTTACTGTCACAATGG - Exonic
956221383 3:66907575-66907597 TTCTCAACAAGCTTTCATAAAGG - Intergenic
957921671 3:86756877-86756899 TCCCCTAGCCACTTTCATCAAGG - Intergenic
957996551 3:87697450-87697472 TTCCTAAAACATTTTCAAAATGG - Intergenic
958913813 3:100025439-100025461 TTCCCCACCCACTTTCAGAAAGG + Intronic
959720324 3:109480050-109480072 TTCTAAAGACACTGTCTTAAGGG + Intergenic
960417627 3:117404170-117404192 TTGCAGAGACACTTTCAGAATGG - Intergenic
961643906 3:128382241-128382263 TTCCCATGACACTTGCCTCAAGG - Intronic
961834834 3:129648973-129648995 TTCCTAAGACAGTTTGAGAAAGG + Exonic
962093326 3:132268372-132268394 TTCCAGGGACACTTTCATAACGG + Intronic
962530518 3:136276328-136276350 TCCCCCAGCCACTTTCATCAAGG - Intronic
964796423 3:160502666-160502688 TACCCAAGACTTTTTCTTAAGGG + Intronic
966261361 3:177983248-177983270 TTCCTAAGATACTTTCCTATTGG - Intergenic
970033108 4:11700318-11700340 TTTGCAAGACTGTTTCATAAAGG + Intergenic
971967745 4:33582926-33582948 TTACTAAGACATTTCCATAATGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
973806155 4:54527874-54527896 TTGCAGAGACACTTTCATAATGG - Intergenic
974419352 4:61652367-61652389 ATCCAAAGAAACTTTCATGATGG - Intronic
974663783 4:64931126-64931148 TTTCCCAGACACTGTGATAAAGG - Intergenic
974796653 4:66761209-66761231 TTGCCAAGACATTTTAAAAAAGG + Intergenic
977322472 4:95535661-95535683 TTACCAAGAGACTTAGATAAAGG + Intronic
978809506 4:112834987-112835009 TTGCCAAGACTCCTTCATAGGGG + Intronic
979434779 4:120674879-120674901 TCCCCCAGCCACTTTCATCAAGG + Intergenic
980036633 4:127891303-127891325 TTCCAGAGACACTATCATACTGG - Intronic
980672941 4:136033118-136033140 TGCCCCAGACACTTTGACAATGG - Intergenic
982191638 4:152862672-152862694 TTCCCATGAAAATTTAATAAAGG + Intronic
983064396 4:163192394-163192416 TTCCCAAGGCACGACCATAAAGG - Intergenic
984204440 4:176769060-176769082 CTCCCAAGCCTCTTTTATAAGGG - Intronic
988179131 5:27766856-27766878 TTCCCAAGATTCTTTCCTTAGGG - Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
993585608 5:89723704-89723726 ATCCTAAGACATTTTCATGATGG - Intergenic
995361090 5:111298553-111298575 TTGCCCAGACACCTGCATAACGG + Intronic
995677873 5:114683799-114683821 TTCCCAACTAACTTTCATCATGG + Intergenic
996311432 5:122110671-122110693 TACCCAAAACAATTTTATAAGGG + Intergenic
997119180 5:131156667-131156689 CTCCAAAGTCTCTTTCATAAGGG + Intergenic
998586222 5:143430594-143430616 CTTCCGAGACTCTTTCATAAGGG - Intronic
999397742 5:151240919-151240941 TTCCCCAGACACCTTCCTTAGGG + Intronic
1000237718 5:159377715-159377737 TTCCCTAGCCACATTCATCAAGG + Intergenic
1002420649 5:179146918-179146940 TTCCCAAGCCACTTTCAAAACGG + Intronic
1002643759 5:180643030-180643052 TTCCCAAGACAATATCTTAACGG - Intronic
1003579104 6:7323272-7323294 TTACCAACACTCTTTCATTAGGG + Intronic
1004387080 6:15182422-15182444 GTCCCCAGACACTTTGATCAAGG + Intergenic
1008129652 6:47706197-47706219 TTACTATGACACTTTCATATGGG - Intronic
1008364207 6:50657225-50657247 TTCCCAAAACAGTTTCCTGAAGG + Intergenic
1008710748 6:54224311-54224333 TTCCTAATTCACTTGCATAAGGG - Intronic
1009930927 6:70176785-70176807 TTCCCAAGTCACTTTCATGGAGG + Intronic
1011548255 6:88503729-88503751 CTCTGAAGACTCTTTCATAAGGG - Intergenic
1012025206 6:93980928-93980950 TTCACAAAACACATACATAAAGG + Intergenic
1012872610 6:104689865-104689887 TTCCCCAGACCCCTTCAGAAAGG - Intergenic
1014619449 6:123647570-123647592 TTCCCATTACACTTTCATCAAGG + Intergenic
1015070440 6:129087591-129087613 TTCCAAAGAAAATTTCAGAAAGG + Intronic
1017951086 6:159136051-159136073 TTCCTAGGAGACTTTCAGAAAGG - Intergenic
1018465907 6:164044707-164044729 TTCCATAGACAGTTTTATAAAGG + Intergenic
1020607679 7:10359013-10359035 TTCCCAAGACACATTCTCCATGG - Intergenic
1021889622 7:25174694-25174716 TTCTCAAGGCACTTCCTTAATGG + Intronic
1022939425 7:35218872-35218894 TTCCTCAGGCTCTTTCATAAGGG - Intronic
1024895441 7:54255811-54255833 TGCCCAAATCTCTTTCATAATGG + Intergenic
1025270680 7:57510533-57510555 GTCCTTAGACAATTTCATAACGG + Intergenic
1028054865 7:86228313-86228335 TTGCCTTGACACTTTCCTAATGG - Intergenic
1028706436 7:93853372-93853394 TTACCAAAACTCTTTCAAAAAGG + Intronic
1031729858 7:125286558-125286580 TTCACAAGACAATATCATAATGG - Intergenic
1031897860 7:127373151-127373173 TTCCCAAGCCACTGGAATAAAGG + Intronic
1034688660 7:152996357-152996379 TTCACAGGACACTTTGAGAAAGG + Intergenic
1041866909 8:62584437-62584459 TACCCAAAACATTTTCATAAAGG - Intronic
1043371608 8:79600411-79600433 TTCCCAAGACATTTACTCAATGG + Intergenic
1043888284 8:85627854-85627876 TTGCCAAAACATTTTCATCAAGG + Intergenic
1044642931 8:94404081-94404103 TTCCCATTACACATTCATAAAGG + Exonic
1051032111 9:12693824-12693846 TTCCCAAACCACTTTCAAAATGG - Intronic
1051984036 9:23060954-23060976 GCCCCAAGACAGTGTCATAAAGG - Intergenic
1052642405 9:31185796-31185818 TTCTCAGGACAAATTCATAAAGG - Intergenic
1058535559 9:105956489-105956511 TTCCAAAGGCACTCTCACAAGGG - Intergenic
1058663601 9:107288824-107288846 TACCCAAAACACATTCTTAAAGG - Intronic
1059195639 9:112368628-112368650 TTCCCATTATAATTTCATAAGGG + Intergenic
1059403957 9:114088637-114088659 TTCGCAAGACAGTTTTGTAAGGG + Intronic
1059887013 9:118757622-118757644 TTCACAAGCCACTTTTATAGTGG + Intergenic
1062367433 9:136217793-136217815 TTAGCAGGACACTTTCTTAAAGG + Intronic
1186375421 X:8993646-8993668 TTCCCAACACAATTTGTTAAGGG - Intergenic
1187057903 X:15758357-15758379 TTCTCAAGCCTCTTTTATAAGGG + Intronic
1193554560 X:82936473-82936495 TTCCCTAGAAATTTTCAAAATGG - Intergenic
1193974419 X:88099728-88099750 TTCCCATGACTCTTTCATTAGGG + Intergenic
1197112023 X:122787455-122787477 TTCCCGAGACAGTTTCCAAATGG - Intergenic
1197287720 X:124615230-124615252 AAGCCAAGACACTTTCATACAGG - Intronic
1199821675 X:151455780-151455802 TTCAAAAGACACTATCAAAAAGG - Intergenic