ID: 947705736

View in Genome Browser
Species Human (GRCh38)
Location 2:232273999-232274021
Sequence GGTTCTGTGTTAGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947705732_947705736 18 Left 947705732 2:232273958-232273980 CCTATTTTTGCTTTTAATGGAGA 0: 1
1: 0
2: 5
3: 63
4: 571
Right 947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 217
947705734_947705736 -10 Left 947705734 2:232273986-232274008 CCCATAAGACAGAGGTTCTGTGT 0: 1
1: 0
2: 1
3: 18
4: 194
Right 947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG 0: 1
1: 0
2: 2
3: 29
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947705736 Original CRISPR GGTTCTGTGTTAGCTGCTGC TGG Intronic
900211826 1:1459931-1459953 GCTCCTGGGTCAGCTGCTGCCGG + Intronic
900623328 1:3597102-3597124 GGAGCTGTGTGAGCTGCTGGTGG - Intronic
900630737 1:3633864-3633886 GGGTCTGTGTCTGCTGCTCCCGG - Intronic
901573245 1:10179202-10179224 GCTTCTTTGTCAGCTACTGCTGG - Intronic
902210186 1:14899380-14899402 GGTTTTAAGATAGCTGCTGCCGG + Intronic
902557674 1:17256547-17256569 GGCTCTGTGTGAGATGCTGGGGG - Intronic
902671934 1:17980539-17980561 GGTTCTGTGATATCTTCAGCTGG + Intergenic
904557499 1:31374734-31374756 GCTCCTGTGTTGGCTCCTGCAGG - Intronic
905807432 1:40887034-40887056 GGCTCAGTGTTTGGTGCTGCGGG + Intergenic
907963193 1:59302542-59302564 GTTTCTGTGTTAGCTGGCTCAGG - Intronic
910108995 1:83661775-83661797 GTTTGTGTTTTAGCTGCTGTGGG - Intergenic
910526186 1:88181022-88181044 GCTTTCGTGTTAGCTGGTGCAGG - Intergenic
911445422 1:97985981-97986003 GGCTCTGTGCTAGGTGCTGGGGG + Intergenic
912536063 1:110372513-110372535 GTTTCTTTGGTAGTTGCTGCTGG + Intronic
913067739 1:115272100-115272122 AGTTCTGTATTGGATGCTGCAGG + Intergenic
914532300 1:148533812-148533834 AGTTCTGTGTTAACTCCTGGAGG - Intronic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
919438054 1:197588122-197588144 GGTACTGGGTTGGGTGCTGCAGG - Intronic
923083528 1:230683347-230683369 GGTTCTCTGTTATTTGCAGCTGG - Intronic
923632105 1:235657442-235657464 TGTTCTCTGTTCCCTGCTGCAGG - Intergenic
924747576 1:246851141-246851163 GTTGCTGTGTTAGCTGCTTTAGG + Exonic
924897689 1:248360141-248360163 GACTCTGTGTTAGCTAGTGCAGG - Intergenic
1063555873 10:7079078-7079100 GCTGCTGTGTCAGGTGCTGCGGG - Intergenic
1064093008 10:12401479-12401501 GGGCCTGTGTTAGGTGCTGGGGG + Intronic
1064127701 10:12677884-12677906 GGTATTGAGTTAGCTTCTGCTGG - Intronic
1068235407 10:54227049-54227071 GGTACTGTGTAAGCTGTTGGTGG + Intronic
1068964713 10:62900455-62900477 TGCTGTTTGTTAGCTGCTGCTGG + Intronic
1070046952 10:72847535-72847557 GGTTCTGTACTATCTGCAGCTGG + Intronic
1070523453 10:77274982-77275004 GGCTGTGTGTTAGCTGCAGGAGG - Intronic
1071621789 10:87126912-87126934 GGTACTGTGTTATATGCTGTTGG + Intronic
1072290767 10:93962249-93962271 GGTACAGTGTAAGGTGCTGCAGG - Intergenic
1072868021 10:99085150-99085172 GGATTTGTCTTTGCTGCTGCTGG - Intronic
1073252036 10:102126411-102126433 GGTACTCTGTTAGATGCTGGAGG - Intergenic
1076144360 10:128105410-128105432 TGGTCTGTGTGAGCTGCTTCAGG + Exonic
1076581922 10:131517575-131517597 GGCACTGTGTCAGCTGCTGGGGG - Intergenic
1076596406 10:131625313-131625335 GTTTCTGTGGTAGCAGCGGCAGG - Intergenic
1076624829 10:131815374-131815396 GTTTCTGTATTTGCTGATGCTGG - Intergenic
1079158171 11:17968138-17968160 GGCTCTGTGTTAGGTGCTGTGGG - Intronic
1080054031 11:27886756-27886778 GGCACTGTGTTAAATGCTGCAGG - Intergenic
1088776199 11:113085764-113085786 AGTACTATGTCAGCTGCTGCAGG - Intronic
1088918871 11:114247219-114247241 AGTTCTGTGGCAGCTGCTTCCGG + Exonic
1090417983 11:126554036-126554058 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1093087876 12:14886686-14886708 GGTACTGTGCTAGGTGCTGTGGG + Intronic
1094399879 12:30050965-30050987 GGCCCTGGGTTAGTTGCTGCAGG + Intergenic
1094766461 12:33600896-33600918 CATTCTGTGTAAGTTGCTGCTGG + Intergenic
1095294357 12:40511267-40511289 GGTTCTGGGGATGCTGCTGCAGG - Intronic
1097983728 12:65760709-65760731 GGTTCAGTGTCAGCTGTTCCAGG + Intergenic
1097993029 12:65856559-65856581 GGTCCTGTGTTAGTTTCTTCAGG + Exonic
1099838028 12:87932647-87932669 GGTTCTCTGTTGGCTCCTGATGG + Intergenic
1100890423 12:99119569-99119591 TGTTCTGTGGGGGCTGCTGCTGG + Intronic
1101605902 12:106247668-106247690 GGTTCTGCGGGTGCTGCTGCGGG + Exonic
1101989246 12:109470911-109470933 TGCTCTGTGTTGGATGCTGCTGG - Intronic
1103112884 12:118297049-118297071 GGTCCTGAGTTTGCTGCTCCTGG + Intronic
1104681213 12:130753169-130753191 TGTTCTGTGTTCGCTCCTGCAGG - Intergenic
1104682677 12:130762188-130762210 GGTTCCCTGTTCGCTGGTGCGGG + Intergenic
1104755082 12:131264239-131264261 GGCTCTGCTTCAGCTGCTGCTGG + Intergenic
1105017914 12:132797318-132797340 GGTTCTGTGCTGGATGTTGCTGG - Intronic
1105442942 13:20430352-20430374 GTCTCTGTGTTGGCTGCTGTGGG - Intronic
1105708547 13:22983425-22983447 GGTCCTGGGTTCCCTGCTGCTGG - Intergenic
1105870945 13:24505861-24505883 GGTCCTGTGTTAGCTTGGGCAGG + Intronic
1112150919 13:96762606-96762628 GGTTCTGTGTAGGCTCCAGCTGG + Intronic
1112837478 13:103533752-103533774 AGTTGTGAGTTAGCTGCTGTTGG + Intergenic
1113211618 13:107989231-107989253 GTTTTTGTGTTAGCTGCTAGTGG + Intergenic
1113402209 13:110004663-110004685 ACTTCTGTGGTAGCAGCTGCTGG - Intergenic
1113638474 13:111938904-111938926 GGTTCTGTGTTAGCAGATCTGGG + Intergenic
1113729030 13:112626434-112626456 GGTTCCGTGTTCACTCCTGCAGG - Intergenic
1113784508 13:112995465-112995487 GCCGCTGTGTGAGCTGCTGCTGG + Intronic
1117747018 14:58879969-58879991 GGCCCTGTGTTAGGTGCTGTGGG - Intergenic
1118041421 14:61921148-61921170 GGTTCTGTGCTAGATGCTGAGGG - Intergenic
1118209957 14:63756447-63756469 GGTTCTTTGTTAACTGCATCAGG - Intergenic
1118689555 14:68324964-68324986 GGCACTGTGTTAGTTGCTGTGGG - Intronic
1119167676 14:72508792-72508814 GGTTCTGATTTAGCAGGTGCAGG + Intronic
1122656177 14:103260831-103260853 GGCTGTGTGTGAGGTGCTGCAGG + Intergenic
1122998986 14:105281823-105281845 GGTGCTTTCTGAGCTGCTGCAGG + Intronic
1123703164 15:22931009-22931031 GGGTCTGTGTTAGAAGCAGCAGG + Intronic
1125857529 15:42964633-42964655 GGTCCTGTGTGAGCTGCCCCTGG + Intronic
1128230070 15:66028221-66028243 GGGTCTGTGCTGGGTGCTGCAGG - Intronic
1128935948 15:71746751-71746773 GATTCTGTGTACGCTGCTGCGGG + Intronic
1130051849 15:80490410-80490432 GGTCCTCTCCTAGCTGCTGCAGG - Intronic
1131981153 15:97996178-97996200 GGTACTGTTCTAGTTGCTGCAGG + Intergenic
1133314623 16:4875013-4875035 GGTCTTGTGAGAGCTGCTGCTGG - Exonic
1135525965 16:23213753-23213775 GGTGCTGTGTGAGGTGCTGGGGG + Intronic
1136185783 16:28588166-28588188 AGTTCTGTGTTTGCTTCTGCTGG + Intronic
1136227250 16:28867172-28867194 GGCTCTGTGTTAGCAGCTGCGGG + Intronic
1137806951 16:51316017-51316039 GGTTCAGTTTTAGCTGCTTCTGG + Intergenic
1139846793 16:69927199-69927221 GGATCTGTGTTGGCTGCCCCAGG + Intronic
1140217480 16:73020046-73020068 GGATCTGTGTGAGATGTTGCAGG - Intronic
1142185220 16:88691666-88691688 GGGCCTGTGTAACCTGCTGCTGG - Intergenic
1142270478 16:89086542-89086564 GGTTCTGTGTCAGCTGTGGCAGG - Intergenic
1142297491 16:89235374-89235396 GATGATGTGTTTGCTGCTGCAGG - Exonic
1142686930 17:1582691-1582713 GGCTCTGTGCTTGCTGCTGCAGG - Intronic
1145877961 17:28334182-28334204 GGTGCTGTGTGAAGTGCTGCAGG + Intronic
1145981782 17:29016938-29016960 GGATCTGAGTCAGCTGCTTCTGG - Intronic
1146491547 17:33286855-33286877 GTTTCTGTACTAGCTGCTGGGGG - Intronic
1146790950 17:35750241-35750263 GGTGCTGTGTTTGCTGGAGCTGG - Exonic
1147747144 17:42701710-42701732 AGTTCTGGCTTAGCAGCTGCAGG - Exonic
1147773355 17:42883140-42883162 GGTACTGTGCTAGGTGCTGGCGG + Intergenic
1147874329 17:43610307-43610329 GGGTCTGTGCAAGCTGCTGGAGG - Intergenic
1148855536 17:50577092-50577114 GGTTCTGTGATAGCACCTTCTGG - Intronic
1148982926 17:51594844-51594866 GTGTCTGTGTTATCTGCTTCTGG + Intergenic
1155821656 18:30385612-30385634 GCTTCTGTGTGAGTTGCGGCTGG - Intergenic
1156456462 18:37297422-37297444 GGCTCTGAGCCAGCTGCTGCGGG - Intronic
1156479231 18:37425877-37425899 GGTTCTCTGTTAGGTGCTGGGGG + Intronic
1157578124 18:48757594-48757616 GGTTCACTGTTATCTGCTACTGG + Intronic
1157713583 18:49866719-49866741 GGCACTGTGCTAGGTGCTGCAGG + Intronic
1160344619 18:78123204-78123226 GGTTCAGTGCTCCCTGCTGCAGG - Intergenic
1161044901 19:2129548-2129570 TGTTCAGTGGGAGCTGCTGCAGG - Intronic
1162768741 19:12936695-12936717 TGTTCTGTGCCAGGTGCTGCAGG + Intergenic
1163698656 19:18776353-18776375 GGTTCTGTGCTAGATGGAGCCGG - Intronic
1164720794 19:30430369-30430391 GGCTCTGTGTTGGGTGCTGGGGG + Intronic
1166527228 19:43519563-43519585 GTTTCAGGTTTAGCTGCTGCAGG - Intronic
1166751748 19:45167143-45167165 AGCTCTGTGTTGGCTGCTGAAGG - Intronic
1168270269 19:55245948-55245970 GGATGAGTGTTAGCTGCTGGGGG - Intronic
1168380044 19:55912571-55912593 CGTTTTTTCTTAGCTGCTGCAGG + Exonic
925097392 2:1218135-1218157 GGTTACCTGTTACCTGCTGCTGG - Intronic
925635393 2:5937292-5937314 GGTCCTGGGTTAGGTGGTGCAGG + Intergenic
925661910 2:6211580-6211602 TGTTCTATCTCAGCTGCTGCTGG + Intergenic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
926166287 2:10523618-10523640 GGTTCTGGGTGAGCTGGTGGTGG + Intergenic
927751242 2:25673020-25673042 GGCTCTGCGTTAGGTGCTGAAGG - Intronic
929781375 2:44959388-44959410 GGCTTTGTGTTAGGTGCTGTGGG - Intergenic
929914882 2:46126683-46126705 GGTTCTGTGTTAGGTCCTATGGG - Intronic
931472004 2:62547842-62547864 GATTCTGTGAATGCTGCTGCTGG - Intergenic
936072733 2:109382255-109382277 GGGTCTGTCTTAGTTGCTGAAGG + Intronic
936474211 2:112825328-112825350 TGTGGTGTGTTACCTGCTGCAGG + Intergenic
936729292 2:115361052-115361074 GCTTGTCTGTTAGGTGCTGCAGG + Intronic
936915106 2:117632297-117632319 GGTTCTGTGCTAGCTGCATGGGG - Intergenic
937521189 2:122713972-122713994 GGTTTTGTGTTAGCTGCTAGTGG - Intergenic
939760722 2:146174348-146174370 GCTTCTGTCTTAGCAACTGCAGG + Intergenic
941118648 2:161502816-161502838 GTTGCTGTGTTAGCTGCTTTAGG + Intronic
941865328 2:170328317-170328339 GGTTCAGTGTTTGTAGCTGCTGG + Intronic
941869429 2:170368198-170368220 CGTTGTATGTTAGATGCTGCTGG + Intronic
942143875 2:173006148-173006170 GGTTGTAAGATAGCTGCTGCTGG - Intronic
942375114 2:175328685-175328707 GGGTTTGTGTTAGCTGCTATGGG + Intergenic
943991254 2:194695687-194695709 TGTCCTGTGTTAGCAGGTGCAGG - Intergenic
944994532 2:205278550-205278572 GGTTTTGAGTTAGCTGATGTGGG + Intronic
946510291 2:220348704-220348726 AGCTCTCTGTTAGGTGCTGCTGG + Intergenic
946605130 2:221395942-221395964 TGTACTGTGATAGCTCCTGCAGG - Intergenic
946628303 2:221639002-221639024 GGAACTGTGTTATCTGCTGGAGG - Intergenic
947083435 2:226423999-226424021 ATTTCTGTGTTACTTGCTGCAGG - Intergenic
947705736 2:232273999-232274021 GGTTCTGTGTTAGCTGCTGCTGG + Intronic
1170592959 20:17785102-17785124 GCTTCTGTGTTTCCTGCTGTAGG + Intergenic
1171445387 20:25199106-25199128 GGTTTTGTGTTGGGTGCTGGAGG + Intronic
1172163133 20:32882391-32882413 GGAACTGTGTGAGGTGCTGCTGG - Intronic
1172447931 20:35002835-35002857 AGCTCTGTGTGAGCTCCTGCCGG - Exonic
1175315759 20:58045440-58045462 AGTGCTGTGTAAGCTGCTGTGGG - Intergenic
1176255777 20:64152172-64152194 AAGTCTGTGTTGGCTGCTGCAGG + Intronic
1179042487 21:37816216-37816238 CGCTCTGTGGTAGGTGCTGCAGG + Intronic
1180221756 21:46363785-46363807 GGTCCTGTTCCAGCTGCTGCAGG - Exonic
1180551469 22:16545208-16545230 GGTCTCGTGTGAGCTGCTGCTGG + Intergenic
1181273266 22:21673220-21673242 GTTTCTGTGATGTCTGCTGCTGG + Intronic
1182041021 22:27239224-27239246 GGCTCTGTGTCAGCTGCAGCTGG + Intergenic
1182070423 22:27459558-27459580 GGTCCTGTGTCAGGTGCTGGGGG - Intergenic
1183717938 22:39545116-39545138 GGCTCTGTGCTAGCTGCTGGGGG + Intergenic
1184282908 22:43449079-43449101 AGTCCTGTGTCAGCTGCTGATGG + Intronic
1184815859 22:46869229-46869251 GATTCTCCGTGAGCTGCTGCTGG - Intronic
949197600 3:1331636-1331658 GGTGCTGTGTTTGATACTGCAGG - Intronic
949301910 3:2593709-2593731 GGATTTGTGTTAGCTGCTTTTGG + Intronic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
952964203 3:38610994-38611016 GCTTCTGTGCCTGCTGCTGCTGG + Intronic
953756025 3:45646498-45646520 GCTGCTGTGTTAGATGGTGCAGG - Intronic
953787088 3:45919519-45919541 GGTTCTGGGTAAGCTGCAACCGG + Exonic
956121350 3:65969337-65969359 GGTTCTGTGTTAGGGGCTGGGGG + Intronic
958445128 3:94205623-94205645 GATTCTCTGTTAGTTGCTTCAGG + Intergenic
959020620 3:101184185-101184207 GGAACTGTGTAAGGTGCTGCTGG + Intergenic
960234552 3:115266785-115266807 TTTTTTGTCTTAGCTGCTGCAGG + Intergenic
962961007 3:140310902-140310924 GCCTCTGTGTTAGGTGCTGCAGG + Intronic
969228632 4:5814888-5814910 GGTCCTGTGTTCTTTGCTGCTGG + Intronic
969256041 4:6002526-6002548 GGTTTGGAGCTAGCTGCTGCAGG - Intergenic
969652882 4:8478142-8478164 GGTTCTGCGCTTGGTGCTGCTGG + Intronic
974102289 4:57430281-57430303 GGTTCTGTATTAACTGATGATGG + Intergenic
979986777 4:127325355-127325377 GGCTCAGTGAAAGCTGCTGCTGG - Intergenic
980861833 4:138508384-138508406 TGTTCTGAGTGAGCTGCTGCAGG + Intergenic
981798525 4:148628542-148628564 TTTTCTCTGTTAGCTTCTGCAGG + Intergenic
982549233 4:156776496-156776518 GCTTCTGTGTTATCACCTGCAGG + Intronic
983511901 4:168617881-168617903 GGTTCTGGGGTAGCTGGTGGAGG - Intronic
984821613 4:183887463-183887485 GGTACTGTGTGAGCTACTGGAGG + Intronic
985569452 5:636915-636937 GGTTGTCTGTCAGCCGCTGCAGG + Intronic
988330179 5:29827486-29827508 GCTTTTGTGCAAGCTGCTGCAGG - Intergenic
988478500 5:31609552-31609574 GGTTCGGTGTTAGGTGATGGGGG + Intergenic
988789962 5:34598671-34598693 GGTTCTGTCTTCCCTGCTGCTGG - Intergenic
991410092 5:66337084-66337106 CCTTCTGTGTGAGCTGCTTCAGG + Intergenic
991523945 5:67534802-67534824 GGTTCTGAGATAGCTGGTTCTGG + Intergenic
992895921 5:81245154-81245176 GGTTTTTTGGCAGCTGCTGCAGG + Intronic
993897639 5:93556731-93556753 GGTTCTTTGCTAGCTTCTGGTGG - Intergenic
995679485 5:114701006-114701028 GTTTCTGTGTGAGCTCCGGCAGG - Intergenic
996378609 5:122841583-122841605 GGTTCTGTTTTTCCTGCTGTTGG + Intergenic
998595023 5:143520482-143520504 GGTACTGTGCTAGGTGCTGTAGG + Intergenic
998888453 5:146720090-146720112 GCATCTGAGTTAGCAGCTGCTGG + Intronic
1002054971 5:176593623-176593645 GGTTCTGTGTGTGGTGCTGCGGG + Intronic
1002571875 5:180144230-180144252 GCTTCTGTGCTGGCTGCAGCTGG + Intronic
1003440284 6:6134537-6134559 GGTTCTTTGCTAGCTGCTGGTGG - Intergenic
1004556664 6:16705099-16705121 GCTTCTGTGTGAACTGCTGTGGG - Intronic
1005124978 6:22436608-22436630 TGTTCTGTGGTAGATGCTGTTGG + Intergenic
1006512275 6:34528147-34528169 GGCACTGTGTTAGGTGGTGCAGG - Intronic
1015695544 6:135976054-135976076 GTTTCTGTGGTATCGGCTGCAGG - Intronic
1016354411 6:143202609-143202631 GATTATGTTTTAGCTGCTGGCGG + Intronic
1018188459 6:161288071-161288093 AGCTCTGTGTTTGCTGCAGCAGG + Intergenic
1018995494 6:168706894-168706916 GTTCCTGTGTTAGCCACTGCAGG + Intergenic
1019201000 6:170315129-170315151 AGCTCTGTGCTGGCTGCTGCAGG - Intronic
1019270539 7:144647-144669 GGTTCTGTGTGAGCTGGAGGCGG + Intergenic
1019451838 7:1102918-1102940 GTTTCTGTTCAAGCTGCTGCAGG - Intronic
1021327057 7:19285670-19285692 GGTTCTGTGTTAGTTTCTACTGG - Intergenic
1023344948 7:39261982-39262004 TTTTCTGAGTTGGCTGCTGCGGG + Intronic
1024629721 7:51236975-51236997 GGTTCTGTGTGCCCTGCTTCCGG + Intronic
1029173412 7:98646646-98646668 TGTTGTGTACTAGCTGCTGCGGG + Intergenic
1029839609 7:103347966-103347988 AGTTCTGTATTATCTGCTGATGG + Intronic
1032457907 7:132087551-132087573 GGATCTGTGTGTGCTGCTGGAGG - Intergenic
1034854289 7:154526462-154526484 GGTACTGTGTTGGATGCTGTGGG - Intronic
1045447771 8:102285235-102285257 GGTTCTGCATTAGCATCTGCTGG - Exonic
1045877212 8:106996246-106996268 TGTGCTGTGGGAGCTGCTGCTGG - Intergenic
1046068289 8:109221740-109221762 TGTTCTTTTTGAGCTGCTGCTGG - Intergenic
1047265970 8:123309553-123309575 AATTGTGTGTAAGCTGCTGCAGG + Intergenic
1047677012 8:127213276-127213298 GGTTCTGTGCTAGCGGCTTGTGG - Intergenic
1048249312 8:132847046-132847068 GTTGCTGTGTTAGCTCTTGCTGG + Exonic
1049040791 8:140110698-140110720 GGTTCAGGGGGAGCTGCTGCAGG - Intronic
1049173990 8:141180186-141180208 GGTTGTGTGTGAGGTGCTACTGG + Intronic
1049528061 8:143139182-143139204 GGTTCTGAATTAGCGACTGCAGG - Intergenic
1049813155 8:144585337-144585359 GGTTCTCGGTGAGCTGGTGCTGG - Intronic
1050560909 9:6833703-6833725 GAATCAGTGTTAGCTGCTGCAGG + Intronic
1053569501 9:39289035-39289057 AGTGCAGTGTTAGCTGCTGCTGG - Intergenic
1053835462 9:42130055-42130077 AGTGCAGTGTTAGCTGCTGCTGG - Intergenic
1054091132 9:60848020-60848042 AGTGCAGTGTTAGCTGCTGCTGG - Intergenic
1054112543 9:61123576-61123598 AGTGCAGTGTTAGCTGCTGCTGG - Intergenic
1054127645 9:61329974-61329996 AGTGCAGTGTTAGCTGCTGCTGG + Intergenic
1054595163 9:67058555-67058577 AGTGCAGTGTTAGCTGCTGCTGG + Intergenic
1056722748 9:89085715-89085737 GGTTCAGTGTTACCTTCTGCAGG - Intronic
1059134214 9:111788495-111788517 GGTTCTGTGTTATCTGATACAGG - Intronic
1059396566 9:114037922-114037944 GGTGCTGTGTGACCTCCTGCAGG + Intronic
1059476186 9:114549808-114549830 GGTTCCGGCTTAGCTACTGCAGG - Intergenic
1059671988 9:116500499-116500521 GGTTCCTTGTTAGCCACTGCAGG - Intronic
1059846914 9:118290159-118290181 GGTTAGGTGTCTGCTGCTGCTGG + Intergenic
1061194470 9:129100270-129100292 GGTTCTCTGTGAGGTGCTGAGGG + Intronic
1062312075 9:135944253-135944275 GATTCTGAGTTTGCTTCTGCTGG - Intronic
1187384854 X:18839253-18839275 GGTTCTGTGTGAGCTCCTGGAGG + Intergenic
1188659905 X:32746363-32746385 GGATCTGTGTGAGATTCTGCTGG - Intronic
1189176331 X:38961284-38961306 GCTTCACTGTTATCTGCTGCTGG - Intergenic
1189916710 X:45862927-45862949 GGCTCTGTAGCAGCTGCTGCTGG + Intergenic
1190297724 X:49038370-49038392 GGTACTGTTTCACCTGCTGCCGG + Exonic
1190744524 X:53314327-53314349 GGTTCTGTGTTAGGTGCTGTGGG - Intronic
1192239714 X:69319449-69319471 GGGTCTGAGTCAGCTGCTGTGGG + Intergenic
1193772280 X:85602271-85602293 GGTTCTGTATTGGTTGCTGAGGG - Intergenic
1195355274 X:104033623-104033645 GTTTCTGGGTTAGGTTCTGCAGG + Intergenic
1195940837 X:110166592-110166614 GGATCAGTCTTGGCTGCTGCTGG + Intronic
1196048707 X:111282537-111282559 GGTTCTGGGTGAGATTCTGCTGG - Intergenic
1198507129 X:137312216-137312238 GGTTCTGGGTTAGCAGGTTCAGG - Intergenic
1199185081 X:144907325-144907347 ATTTCTGTGTTAGCTGTTCCTGG - Intergenic
1199901342 X:152175425-152175447 GGTTCTGTGCTAGGTGCTTGGGG + Intronic
1201420043 Y:13788322-13788344 TGTGCAGTGTTAGCTCCTGCCGG - Intergenic