ID: 947710740

View in Genome Browser
Species Human (GRCh38)
Location 2:232314109-232314131
Sequence GAGCCCTCTGGGCCTGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 381}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947710733_947710740 2 Left 947710733 2:232314084-232314106 CCCTGATTTCCATTGCCATGGAA 0: 1
1: 1
2: 2
3: 28
4: 232
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710728_947710740 15 Left 947710728 2:232314071-232314093 CCATCCCACCTTTCCCTGATTTC 0: 1
1: 0
2: 5
3: 70
4: 753
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710736_947710740 -7 Left 947710736 2:232314093-232314115 CCATTGCCATGGAAAGGAGCCCT 0: 1
1: 0
2: 1
3: 18
4: 170
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710731_947710740 7 Left 947710731 2:232314079-232314101 CCTTTCCCTGATTTCCATTGCCA 0: 1
1: 0
2: 3
3: 45
4: 431
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710734_947710740 1 Left 947710734 2:232314085-232314107 CCTGATTTCCATTGCCATGGAAA 0: 1
1: 0
2: 3
3: 43
4: 229
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710726_947710740 17 Left 947710726 2:232314069-232314091 CCCCATCCCACCTTTCCCTGATT 0: 1
1: 0
2: 0
3: 32
4: 452
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710725_947710740 21 Left 947710725 2:232314065-232314087 CCTGCCCCATCCCACCTTTCCCT 0: 1
1: 1
2: 7
3: 127
4: 1175
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710730_947710740 10 Left 947710730 2:232314076-232314098 CCACCTTTCCCTGATTTCCATTG 0: 1
1: 0
2: 2
3: 37
4: 451
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710727_947710740 16 Left 947710727 2:232314070-232314092 CCCATCCCACCTTTCCCTGATTT 0: 1
1: 0
2: 1
3: 31
4: 392
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381
947710729_947710740 11 Left 947710729 2:232314075-232314097 CCCACCTTTCCCTGATTTCCATT 0: 1
1: 0
2: 10
3: 123
4: 1798
Right 947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG 0: 1
1: 0
2: 3
3: 39
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947710740 Original CRISPR GAGCCCTCTGGGCCTGCCTG TGG Intronic
900154045 1:1197036-1197058 GAGCCCACTGGGCCAGCAGGAGG - Intronic
900602084 1:3507089-3507111 AAGCCCTGTGTGGCTGCCTGGGG + Intronic
900682572 1:3924968-3924990 GACTCCTCTGGCCCTGGCTGGGG - Intergenic
900810371 1:4797238-4797260 CAGCCTTCTGGACCTGTCTGTGG - Intergenic
901008378 1:6183043-6183065 GAACCCCCAAGGCCTGCCTGAGG + Intronic
901219416 1:7574701-7574723 CAGCCGTCTGTGCCTTCCTGGGG + Intronic
902777133 1:18682297-18682319 GAGGCCTCTGGGGCAGCCAGAGG + Intronic
902820312 1:18939250-18939272 GAGCCCTCTGGGGCCACATGGGG + Intronic
903003675 1:20284254-20284276 GTGCCCTGTGAGCTTGCCTGTGG + Intergenic
903153157 1:21427659-21427681 GCGCCCACGGGTCCTGCCTGCGG + Intergenic
903159975 1:21480326-21480348 GCGCCCACGGGTCCTGCCTGTGG - Intronic
903251029 1:22053088-22053110 GAGCCCGCCGGGCCGGGCTGGGG - Intronic
904145396 1:28386976-28386998 GAGCCATCTCGCCCAGCCTGAGG - Intronic
905451417 1:38059277-38059299 TAGCACTCTGAGCCTGCCTTGGG + Intergenic
905850777 1:41273056-41273078 AAGTCCTCAGGGCCTGCATGTGG - Intergenic
906689022 1:47780588-47780610 GAGGCCTCTAAGCCAGCCTGGGG + Intronic
907490357 1:54805468-54805490 GAGGCCTCTGACCCAGCCTGTGG - Intergenic
908958838 1:69670613-69670635 GGGACCTCTGGACCTCCCTGGGG - Intronic
910221056 1:84889761-84889783 GAGCTGAGTGGGCCTGCCTGGGG + Intronic
912683005 1:111740565-111740587 GAGACCTCTAATCCTGCCTGGGG - Intronic
913975293 1:143450705-143450727 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
914069686 1:144276321-144276343 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
914109469 1:144690033-144690055 GTGCCCGATGGGGCTGCCTGGGG + Intergenic
914629422 1:149494593-149494615 GCGCCCACAGGTCCTGCCTGCGG - Intergenic
914629956 1:149499348-149499370 GCGCCCACAGGTCCTGCCTGCGG - Intergenic
914630490 1:149504109-149504131 GCGCCCACAGGTCCTGCCTGCGG - Intergenic
917506141 1:175628843-175628865 GATCCCTCTGGGCCTGCAGTGGG + Intronic
918175459 1:182040578-182040600 CAGCCCTTTGGGGCTGCCTTGGG + Intergenic
919085689 1:192917898-192917920 GGGCCCTCTGGGCTGGCCTTTGG - Intergenic
919690861 1:200527287-200527309 GGGGCTTCTGGGCCTGACTGTGG + Intergenic
922152964 1:223020942-223020964 CAGCCCTCTGTCCCTGCCTACGG + Intergenic
922753591 1:228082339-228082361 GAGGCCTCGGGGACTGCGTGAGG - Intergenic
923554181 1:234987695-234987717 CTGATCTCTGGGCCTGCCTGTGG - Intergenic
923743149 1:236674453-236674475 GAGACTTCTGGGAATGCCTGGGG + Intergenic
924371148 1:243351164-243351186 GGGCCATTTGGGCCTGCCTTTGG + Intronic
924740651 1:246792747-246792769 GAGCCCTCGCGGCCGCCCTGGGG + Intergenic
924740684 1:246792839-246792861 GAGCCCTCGCGGCCGTCCTGGGG + Intergenic
924740694 1:246792869-246792891 GAGCCCTCGCGGCCGTCCTGGGG + Intergenic
1063174503 10:3539477-3539499 GCCGCCTCTGGGGCTGCCTGGGG - Intergenic
1067141513 10:43661117-43661139 GAGCCATCAGGTCCTGCCTGGGG + Intergenic
1067239282 10:44476603-44476625 CAGCCCTCTGTGAATGCCTGTGG + Intergenic
1067738518 10:48877837-48877859 GTGTCCTCTTGGCCTGGCTGGGG + Intronic
1067770158 10:49116741-49116763 GAGACCTCTGGAAGTGCCTGGGG - Intergenic
1068805015 10:61185656-61185678 GAGCCATCATGCCCTGCCTGTGG - Intergenic
1069774711 10:70919617-70919639 CAGCCCTCTGGGCCTGGGGGAGG + Intergenic
1070635854 10:78126584-78126606 GAGCCCTCTGGTTTTGCCTATGG + Intergenic
1071224503 10:83512618-83512640 TACCCCCCTGGCCCTGCCTGAGG - Intergenic
1072247547 10:93556678-93556700 CAGCACTCTGGCGCTGCCTGTGG - Intergenic
1072766738 10:98100734-98100756 AAATCTTCTGGGCCTGCCTGGGG + Intergenic
1073094518 10:100971589-100971611 GCACCCTCTGGCCCTGCCTGTGG + Intronic
1074197811 10:111204859-111204881 GTGCCATCTGGTCCTCCCTGTGG - Intergenic
1074421203 10:113310052-113310074 GAGCGCTGTGGGCCTGGGTGGGG - Intergenic
1074455269 10:113590595-113590617 GGGCCTTCTGAGCATGCCTGAGG + Exonic
1075597629 10:123743700-123743722 GAGCCCTCAGGGCCTCTCAGAGG - Intronic
1075689839 10:124387431-124387453 GAGCCCTCTGGGATCACCTGAGG - Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076090891 10:127684580-127684602 GAGCCCTGTGGGCTTTCCTGTGG - Intergenic
1076350377 10:129811245-129811267 GACCTCTCAGGGCCTGGCTGGGG - Intergenic
1076424123 10:130355282-130355304 CAGCCCTCTAGGCCTGCGGGTGG + Intergenic
1076617991 10:131769544-131769566 GGGCCCTCTGGGCCGCCCCGAGG - Intergenic
1076879918 10:133235272-133235294 GAGCACTCTGGGACCACCTGAGG - Intergenic
1076889773 10:133277733-133277755 GGGGCCTCAGGGCCTCCCTGGGG + Intergenic
1077223318 11:1426901-1426923 AAGCCCCCTGGGTCTGCATGCGG + Intronic
1077464894 11:2729081-2729103 GCGCCCTTTGTGCCCGCCTGGGG - Intronic
1078341380 11:10499937-10499959 GGGACCCCTTGGCCTGCCTGAGG - Intronic
1081877064 11:46415813-46415835 AAGCCATCTTGGGCTGCCTGGGG - Intronic
1081915973 11:46730471-46730493 GAGCACTCTTGGCTTGTCTGGGG + Intronic
1082818685 11:57528715-57528737 CAGAGCTCTGGGCCTGCATGAGG - Exonic
1083103816 11:60337619-60337641 GATCCCTCCGGGACTTCCTGAGG + Intronic
1083466826 11:62852952-62852974 GAACCCACTGGGACTGGCTGGGG - Intergenic
1083621817 11:64053083-64053105 CAGCACGCTGGGCCTGCCTGAGG + Intronic
1083704058 11:64500965-64500987 GGGCCGGCTGGGCCTGCTTGTGG + Intergenic
1084192772 11:67506302-67506324 GAGAGCCCTGGGCCTTCCTGTGG - Intergenic
1084230174 11:67746438-67746460 GGCACCTCTGGGCTTGCCTGTGG - Intergenic
1084274989 11:68046774-68046796 GTGCCAGCTGGGGCTGCCTGTGG + Intronic
1084605528 11:70169657-70169679 GAGGCCTCTGGTCCTGCCTGAGG - Intronic
1084968785 11:72758223-72758245 GGGTCCTCTGGTCCTCCCTGAGG - Intronic
1084974294 11:72788081-72788103 GAGTGCTGTGGGCCTGCTTGGGG + Intronic
1085052451 11:73386858-73386880 CAGCCCTCTGGGCCTACCTTGGG + Intronic
1086237527 11:84649746-84649768 GATTCCTCTGAGACTGCCTGTGG + Intronic
1087835263 11:102867691-102867713 GAGGCCTCTGGTTCTGCCTCTGG + Intronic
1089776778 11:120843235-120843257 GGGAGCTCTGGCCCTGCCTGGGG - Intronic
1089970832 11:122691901-122691923 GATGGATCTGGGCCTGCCTGGGG - Intronic
1090182833 11:124716112-124716134 GTATCCTCTGGGCCTTCCTGGGG - Intergenic
1090237352 11:125159263-125159285 AAGCGCTCAGGGCCTGCATGTGG + Intergenic
1090502592 11:127275949-127275971 GGCACCTCTGGGCCTGCTTGCGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091345221 11:134847746-134847768 GAACCCTATGGGCCTTCCTAAGG + Intergenic
1091974023 12:4810543-4810565 GAGAGCTCTGGGCCGGCCAGGGG + Exonic
1093262333 12:16954124-16954146 AAGCCCTCCTGGGCTGCCTGGGG - Intergenic
1094258643 12:28465253-28465275 CACACCTCTGGACCTGCCTGAGG + Intronic
1096124015 12:49106565-49106587 GAGGTCTCTGGTCCTGGCTGTGG + Intronic
1096263354 12:50106238-50106260 GTGCCCTTTGGGCCCACCTGCGG - Intronic
1096572337 12:52530812-52530834 GAGTCCTCTGGGACTATCTGGGG - Intergenic
1098029641 12:66240648-66240670 GGCCCCTCTGGGACAGCCTGAGG - Intronic
1101830048 12:108249866-108249888 GAGCCCCCTGGGTGGGCCTGGGG - Exonic
1102006901 12:109594984-109595006 GTTCCCACTTGGCCTGCCTGAGG - Intronic
1102759831 12:115375565-115375587 GCCCCCTCTGTTCCTGCCTGAGG + Intergenic
1103939475 12:124494102-124494124 AAGCTCACTGGCCCTGCCTGGGG - Intronic
1104469648 12:129019208-129019230 GAGGCCTCTGTTCCTGGCTGTGG - Intergenic
1104564066 12:129864457-129864479 GAGTCTTATGGGTCTGCCTGTGG - Intronic
1104959390 12:132480996-132481018 GTGCACTGTGGGCCTCCCTGAGG + Intergenic
1106082913 13:26515372-26515394 GAGCCATCCTGGCCTGTCTGAGG - Intergenic
1106297501 13:28429924-28429946 GAGCTCTCTGGGGCTGTCTGAGG + Intronic
1106591408 13:31101853-31101875 GAGTCTTCTGGGCCTGCCTCAGG + Intergenic
1112416711 13:99208986-99209008 GAGTCCTTTTGGCCTGCCTGGGG + Intronic
1112597268 13:100818892-100818914 CAGCCCTCTGGCCATGCCTGGGG - Intergenic
1113104635 13:106759136-106759158 GAGCCCTCTGGGACAGGCTGAGG + Intergenic
1113104683 13:106759390-106759412 GAGCCCTCTGGGACAGGCTGAGG + Intergenic
1113465211 13:110507853-110507875 CAGCCTCCTGGGCCTGGCTGGGG + Intronic
1113910715 13:113839997-113840019 GAGCCCTCTGTGCTGGCCTAGGG + Intronic
1113939604 13:114011569-114011591 GAGTCTCCTGGCCCTGCCTGGGG + Intronic
1114566350 14:23635872-23635894 GTGCCAGCTGGGCCTGACTGGGG + Intronic
1115022890 14:28704480-28704502 GAGTCTTTTGGGCCTTCCTGGGG - Intergenic
1117952893 14:61100555-61100577 GGAACCACTGGGCCTGCCTGTGG + Intergenic
1121729607 14:96177146-96177168 GAGCCCCCAGGGCCTGCGTGTGG - Intergenic
1122236032 14:100331011-100331033 GTGGCCTCTGGCCCTGCCAGAGG - Intergenic
1122388122 14:101362665-101362687 GAGCACTGTGGGCCTGCTGGAGG - Intergenic
1122401883 14:101472222-101472244 GGGCCCTCTGGGGCAGCGTGTGG + Intergenic
1122464647 14:101922987-101923009 GAGCCTTCCGGGTCTGCCCGTGG + Intronic
1122920156 14:104876651-104876673 GAGCCTTCTGGGGAGGCCTGGGG - Intronic
1123006960 14:105328370-105328392 GCCTCCTCTGGGCCTTCCTGGGG + Intronic
1123722836 15:23074801-23074823 GGGCCCTCTGGGCCTTGATGTGG + Intergenic
1124477123 15:30044955-30044977 CAGCTCTCTGGACCTTCCTGTGG + Intergenic
1124604386 15:31160074-31160096 GAGCCCTCAGGGCATGCAAGTGG + Intronic
1124876718 15:33601605-33601627 GAGCCCTCTTTTCCTGCTTGGGG - Intronic
1125044418 15:35230124-35230146 GACGCCTCTGGACCTGCCTGGGG - Intronic
1125514193 15:40308790-40308812 TGGGCCTCTGGGACTGCCTGAGG + Intergenic
1125521054 15:40347999-40348021 CAGCCCTGGGGACCTGCCTGCGG - Intergenic
1125678049 15:41512912-41512934 GACCCCTCTGGCCCAGCCAGGGG - Intronic
1127264076 15:57347044-57347066 GAGGCCTCTGTTCCTGCCAGCGG + Intergenic
1127567717 15:60209311-60209333 GAGTCCTCTAGGATTGCCTGAGG - Intergenic
1128299589 15:66557616-66557638 GAGCTCACTGGGCCTGGGTGAGG - Intronic
1128537304 15:68500851-68500873 GAGCTCTCAGGCCCTCCCTGTGG - Intergenic
1128765947 15:70251168-70251190 GAGGCTTCTGGGCCTGCTTCTGG + Intergenic
1129537980 15:76329792-76329814 CGGCCATGTGGGCCTGCCTGGGG + Intergenic
1129729479 15:77921800-77921822 GTGCCATCTCGGCCTCCCTGTGG - Intergenic
1131054417 15:89367303-89367325 GAGCGCTCTCGGCCCTCCTGTGG + Intergenic
1131777211 15:95815619-95815641 GAGTCGTCTGGGCCTTGCTGAGG + Intergenic
1133584136 16:7175542-7175564 GAGCCCTATGTGCCTACCTGTGG - Intronic
1133963674 16:10516144-10516166 GAGCTCTCTCTGCCTCCCTGTGG - Intergenic
1135413841 16:22254240-22254262 GAGCCCTCTGGCCCAGCAGGTGG + Intronic
1136075382 16:27813697-27813719 CCGCCCTCTGGGCCTGACTAGGG + Intronic
1136147397 16:28323475-28323497 GACCCCTCTGAGCTGGCCTGTGG + Exonic
1136277070 16:29185137-29185159 GAACCCTCAGGGGCCGCCTGGGG + Intergenic
1139472646 16:67186492-67186514 GAGCCCCTTTGGGCTGCCTGGGG + Intronic
1141029247 16:80573483-80573505 GAGCCAGCTGGGACTGCCTTGGG + Intergenic
1142081446 16:88151182-88151204 GAACCCTCAGGGGCCGCCTGGGG + Intergenic
1142519816 17:497090-497112 GAGACCTTTGAGCCTGCCTTTGG - Intergenic
1143017061 17:3896481-3896503 GATCCCTCTGGATCTGCCGGTGG - Intergenic
1143151371 17:4809158-4809180 GAGCCCTCAGGACCTGCCCGGGG - Exonic
1143393601 17:6575252-6575274 GAGCACTGAGGGCCTCCCTGTGG + Intergenic
1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG + Exonic
1144572494 17:16408192-16408214 GTGGCCTCTGGGGCTCCCTGGGG + Intergenic
1144814121 17:18021378-18021400 GAGCACTCTGGTCTTCCCTGGGG + Intronic
1146057681 17:29589399-29589421 CAGCCCTCTGGGCCAGCGTGGGG + Exonic
1146059648 17:29597797-29597819 GAGCCATCCAGGCCTCCCTGGGG + Intronic
1148106892 17:45123774-45123796 GACCCCTTGGGGCCAGCCTGTGG + Intronic
1148221767 17:45867890-45867912 TGGCCCTCTGGGGTTGCCTGGGG - Intergenic
1148912465 17:50950191-50950213 AAGCTCTAGGGGCCTGCCTGGGG - Intergenic
1149549966 17:57532871-57532893 CAGCCCTGTGGGGCAGCCTGGGG + Intronic
1149604497 17:57915327-57915349 GGGACCTCTGAGCGTGCCTGTGG - Intronic
1151579232 17:74968725-74968747 GAGCCATCTGGGAGTGCCTCTGG + Intronic
1151623540 17:75262035-75262057 GGGCCCACGCGGCCTGCCTGTGG - Intronic
1151894730 17:76972310-76972332 GAGCCATCTGACCCAGCCTGGGG - Intergenic
1151936592 17:77265684-77265706 GAGCCCTCCGGACCTGCAGGAGG - Intergenic
1151947888 17:77329450-77329472 GAGCCCAGTGGTCCTGGCTGTGG + Intronic
1152057282 17:78039851-78039873 CTGTCCTCTGGGGCTGCCTGGGG - Intronic
1152078264 17:78171507-78171529 CAGCTCTCTGGACCTTCCTGTGG + Exonic
1152237358 17:79145534-79145556 GAGCCGACTGGGCTGGCCTGTGG - Intronic
1152401792 17:80070898-80070920 TGTCCATCTGGGCCTGCCTGTGG + Intronic
1152960920 18:79758-79780 GACCTCTCTGTGCCTTCCTGAGG - Intergenic
1153519421 18:5937919-5937941 GTGCCCTCTCTGCCTGCCTGGGG - Intergenic
1157535335 18:48453333-48453355 GAGACCTCTGGGGTTGTCTGAGG + Intergenic
1157584342 18:48791533-48791555 GAGCCCCCAGGGCCAGGCTGAGG - Intronic
1158402160 18:57131022-57131044 TAGGCCTCTGGGGCTGCGTGAGG - Intergenic
1158890965 18:61871289-61871311 CATTCCTCTGGGCCTGCCTCTGG + Intronic
1160321727 18:77902478-77902500 GAGCACTTTGGGCCTGCCTGGGG + Intergenic
1161009088 19:1951502-1951524 GTGTCCTCTGGGGCTCCCTGAGG + Intronic
1161073904 19:2275827-2275849 GAGCGCTCGGGCCCTGGCTGCGG - Exonic
1161395963 19:4045151-4045173 GAGCCCTCTGGGACTTCCGTAGG - Exonic
1161554985 19:4936087-4936109 GAGCCCTCTGGGGATGCAGGAGG + Intronic
1161560759 19:4971331-4971353 GAGCCCTCTGGGGTGGCCAGGGG + Intronic
1161772548 19:6238912-6238934 GAGCCCTGTGGGGCTGGGTGTGG + Intronic
1162505784 19:11084037-11084059 GAGACCTCGGTGCCTGCCAGTGG - Intergenic
1162567108 19:11450690-11450712 CGCCCCTCTGGGCCTGCCTGTGG + Exonic
1162788523 19:13051217-13051239 GAGCCCTCTGGCCCTGAGTGGGG - Intronic
1162930141 19:13953456-13953478 GAGCTCCCTGGGCTTGGCTGTGG + Intronic
1162948253 19:14056435-14056457 GCGCCAGCTGGGCCTGCCTGAGG + Exonic
1163148569 19:15398459-15398481 GCGCCCGCTCGGCCTGCCAGAGG + Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163528655 19:17836707-17836729 GAGGCTGCTGGGCCAGCCTGGGG - Intronic
1163696936 19:18768809-18768831 GGTCCCTCGGGGCCTGACTGGGG + Intronic
1163747805 19:19058389-19058411 GAGCCCTCCGGCCCTGCAGGTGG - Intronic
1165076329 19:33281739-33281761 GTGCTGTCTGGGCTTGCCTGGGG + Intergenic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1165631619 19:37306336-37306358 GAGGCTTCAGGGGCTGCCTGGGG - Intergenic
1165948304 19:39458404-39458426 GAGCCCTCAGGGCCAGACCGGGG - Intronic
1166216062 19:41335890-41335912 GAGGCCTCTGGGCTCCCCTGGGG - Intronic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1166335744 19:42105853-42105875 GACCCCTCTCTGCCTGCCTGGGG - Intronic
1167393335 19:49211090-49211112 GAGGCCTTGGGGCCTGGCTGGGG + Intronic
1167604760 19:50475905-50475927 GAGCCGTCTGGGACGGCCCGTGG + Exonic
926008318 2:9389719-9389741 CTGGCTTCTGGGCCTGCCTGGGG - Intronic
926111746 2:10188197-10188219 CAGCCCGGTGGTCCTGCCTGGGG + Intronic
927208930 2:20627012-20627034 CAGCCTCCTGGGCCTGCTTGGGG - Intronic
927521699 2:23702978-23703000 TAGCCCTCTCGGCCTTCCTCTGG - Intronic
928214137 2:29347247-29347269 GGGGTCTCTGGCCCTGCCTGAGG + Intronic
928240077 2:29578546-29578568 GGGCCCTCAGGGCCTGTTTGGGG + Intronic
929532618 2:42762272-42762294 GAGCCCTGGTGGCCTGCCTGAGG + Intergenic
929574159 2:43041766-43041788 GAGCCCCCAGTGCCTGCCAGGGG + Intergenic
932345537 2:70993046-70993068 GTGCACTCTGGGCATGGCTGAGG - Intronic
932447786 2:71791343-71791365 GAGCCCTTTGGGCCAGCAAGGGG - Intergenic
932792911 2:74671433-74671455 GAGCCCTGTGGTTCTGGCTGAGG + Intronic
934179993 2:89611678-89611700 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
934290288 2:91685939-91685961 GTGCCCGATGGGGCTGCCTGGGG - Intergenic
936013952 2:108943805-108943827 CAGCCCTCTGCCCCAGCCTGAGG - Intronic
937040329 2:118815821-118815843 CACACCTCTGGGCCTGCCAGAGG - Intergenic
937289986 2:120776344-120776366 GAGCCCACTGGGCCTCCCTTTGG - Intronic
937377309 2:121346229-121346251 GGGGCCTCAGGACCTGCCTGTGG - Intronic
937911591 2:127078189-127078211 AAGGCTTCTGGGCCTGGCTGGGG - Intronic
938767603 2:134470759-134470781 GAGCCATCTGGGCCTGGGTAGGG - Intronic
940849671 2:158676082-158676104 CAGTCCTCTGGGCCTTTCTGAGG + Intronic
945196389 2:207241052-207241074 CAGCCCTTTGCCCCTGCCTGAGG + Intergenic
946410053 2:219511273-219511295 GAGGTCTCTGGGTCTGCCTTTGG + Intergenic
946946594 2:224828525-224828547 CTGTCTTCTGGGCCTGCCTGGGG - Intronic
947338449 2:229111276-229111298 GATGCCTCTGCCCCTGCCTGTGG - Intronic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
947983055 2:234426222-234426244 GAACCCTCAGGACCTGCCTTTGG + Intergenic
948248370 2:236505485-236505507 GAGCCCTCTGTCTCTGGCTGTGG + Intronic
948808115 2:240461607-240461629 GAGCACCCCGGGCCTGTCTGAGG - Intronic
949014574 2:241702179-241702201 GAGCCCACGGGGTCTGCATGCGG - Intronic
949076742 2:242064036-242064058 GTGTCCTCAGGACCTGCCTGTGG - Intergenic
1168849585 20:967363-967385 GGGCCCACTGGGTCTGCCCGAGG + Intronic
1169205904 20:3740267-3740289 CAGCCAGCTGGGCCTGTCTGTGG + Intronic
1171230106 20:23477371-23477393 GAGCCCTCTGTGTGTGGCTGAGG + Intergenic
1171849084 20:30295429-30295451 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1172972041 20:38880923-38880945 GAGCCCTCGGGCCCTGCTGGTGG - Intronic
1173161296 20:40654334-40654356 CAGGCCTCTGGCTCTGCCTGCGG - Intergenic
1173519200 20:43686660-43686682 TAGCCCACAGGGCCTACCTGAGG - Intronic
1173879426 20:46400540-46400562 GGGCCCTCTGGGCCTGGATATGG - Intronic
1175875401 20:62227238-62227260 GAGCCCTCTCGGCCTTTCAGAGG - Intergenic
1175883579 20:62274692-62274714 GAGCTCGCTCCGCCTGCCTGGGG + Intronic
1178429496 21:32506597-32506619 GGTGCCTCTGGGCTTGCCTGTGG + Intronic
1179028082 21:37697030-37697052 GATACCTCTTGGCCTGACTGTGG - Intronic
1179448062 21:41447440-41447462 CAGCACTCTGTGCCTGTCTGTGG - Intronic
1180157096 21:45983075-45983097 GAGCCCTCTCGGTCAGCCTGCGG - Intronic
1180184573 21:46133056-46133078 GAGCACTTTGGGCCTGGCTGGGG - Intergenic
1180913392 22:19469128-19469150 CATCCTTCTGTGCCTGCCTGTGG - Intronic
1181175637 22:21033196-21033218 GGGCCCTCCCGGCCTGCCAGAGG - Intergenic
1181559691 22:23692863-23692885 GAGGACTCTGGGGCTGACTGTGG - Exonic
1181597588 22:23926714-23926736 CACCCCTCTGGGGCTACCTGAGG + Intergenic
1181600877 22:23951302-23951324 GAGCCCCCTGGGCAGGCCAGAGG + Intergenic
1181607636 22:23990024-23990046 GAGCCCCCTGGGCAGGCCAGAGG - Intergenic
1182116688 22:27760702-27760724 TAGTCCCCTGGGCCTGCCTCGGG - Intronic
1182624775 22:31637970-31637992 GCGGCCTCTGGGTCTGTCTGGGG - Intronic
1183195188 22:36348860-36348882 GAGCCCTCAGACCCAGCCTGCGG + Intronic
1183524354 22:38314866-38314888 GAGCCCTCTGCTCTGGCCTGGGG + Intronic
1184036275 22:41919821-41919843 GAGCCCTGGGGGCCTGGATGCGG - Intergenic
1184223441 22:43115259-43115281 GAGTCCCCCGTGCCTGCCTGGGG + Intronic
1184382606 22:44155307-44155329 GGGGCCTCTGGGCCTCCGTGGGG + Intronic
1184401186 22:44275492-44275514 GACCCCTGAGGTCCTGCCTGGGG + Intronic
1184497120 22:44848426-44848448 GAGGCCACTGCCCCTGCCTGCGG - Intronic
1184649957 22:45915188-45915210 TAGCCCACTGGGCCTGGCAGGGG + Intergenic
1184999963 22:48239318-48239340 CAGCTCTCAGGGCCTTCCTGTGG + Intergenic
1185272794 22:49936407-49936429 GCGCCCTGTGGGCGGGCCTGGGG - Intergenic
949829184 3:8196422-8196444 GGCCTCTCTGGACCTGCCTGGGG - Intergenic
949888180 3:8712799-8712821 GGGCCCCCAGGGGCTGCCTGGGG - Intronic
950095729 3:10329166-10329188 GAGCCCCCCGAGCCTGGCTGTGG - Intronic
950423848 3:12914290-12914312 GAGCCATCAGGGCCTGGCTCTGG + Intronic
953454878 3:43033226-43033248 GAGGCCTGGGGACCTGCCTGAGG + Exonic
953813601 3:46134812-46134834 GAGGCCTCTGGACCTCCCAGAGG - Intergenic
954619213 3:51986179-51986201 CAGCCTGCTGGCCCTGCCTGTGG + Intronic
954870406 3:53763438-53763460 GGGCCCTTTCTGCCTGCCTGAGG - Intronic
955507260 3:59644860-59644882 GAACCCTCTGTGCCCGCTTGGGG - Intergenic
955929670 3:64044163-64044185 GGGCCCTCTGGGTCTGGATGTGG - Intergenic
956059246 3:65333173-65333195 GAGCACTCTGGGCCTGGCTAAGG - Intergenic
956217264 3:66861355-66861377 AAGCCATCTTGGCCTGCATGTGG + Intergenic
960311505 3:116121803-116121825 AAGCCATCTGGGGCTGCATGTGG - Intronic
961878806 3:130045534-130045556 GGGGCCTCTGGGCTTGCCTGTGG - Intergenic
962314228 3:134349036-134349058 GACCCATGTGTGCCTGCCTGAGG + Intergenic
964341610 3:155714358-155714380 GAGCCCTCTGGACCTGACCCAGG - Intronic
966344914 3:178968518-178968540 CATCCCTCTGCCCCTGCCTGTGG - Intergenic
967299294 3:187996831-187996853 CAGGCCTCTGGTCCTGCATGTGG - Intergenic
967947295 3:194814155-194814177 GAGCCCTCTGGGCCTGGAGAAGG + Intergenic
968057726 3:195705503-195705525 GAGCCCTGTGGGCCTGGGTGTGG - Intergenic
968288689 3:197522825-197522847 GAGTCCTCAGGGTCTGCCTCAGG - Intronic
968451783 4:679346-679368 CAGCTCTGTGGTCCTGCCTGGGG - Intronic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968622758 4:1611097-1611119 GGGGCCTCTGGGCCACCCTGAGG + Intergenic
968733057 4:2280739-2280761 GCACCCTCGGGCCCTGCCTGTGG + Intronic
968910077 4:3473077-3473099 GAGCCCCCTGGGCCACACTGAGG - Intronic
968974816 4:3816531-3816553 GACCCTGCTGGGCCAGCCTGGGG + Intergenic
969061393 4:4438093-4438115 GAGCCCTGTGTGCCGGCCTCAGG - Intronic
969311392 4:6354721-6354743 GAACCCTCTGAGCCTGTCTCTGG - Intronic
969346013 4:6570602-6570624 GTGCCTTGTGGGCCTCCCTGAGG + Intergenic
969704337 4:8783862-8783884 GAGGCCCCTTGGCCTTCCTGCGG - Intergenic
969829286 4:9781952-9781974 GTGCCCGATGGGGCTGCCTGGGG + Exonic
972468695 4:39383690-39383712 GGCACCTCTGGACCTGCCTGGGG - Intergenic
975529528 4:75386113-75386135 GGGCCCTGTGGTCTTGCCTGTGG - Intergenic
975612783 4:76218041-76218063 GAGCCACCTGGCCCGGCCTGTGG - Intronic
975798298 4:78032399-78032421 GTGTCCTCTGGGTGTGCCTGAGG - Intergenic
977707414 4:100086900-100086922 TAGGCCTCTGGGCCTGTGTGGGG + Intergenic
982467375 4:155747735-155747757 AAGCCATCTGAGCCTGCATGGGG + Intergenic
983373568 4:166896434-166896456 GAAAGCTTTGGGCCTGCCTGGGG + Intronic
985544890 5:504599-504621 GAGCCCTCTGGGCTCACCCGGGG - Intronic
985704061 5:1390525-1390547 GAGCCCCCAGGGCCTGCCTTGGG - Intergenic
985854977 5:2417479-2417501 CAGCCCTCCCAGCCTGCCTGAGG - Intergenic
990471610 5:56121046-56121068 GCGCCATCTTGGCCTGCCTGTGG - Intronic
992416472 5:76556829-76556851 TAGGCCTGTGGGCCTTCCTGAGG + Intronic
997660583 5:135586537-135586559 GAGCCTTCTGGGTCTGCCATGGG + Intergenic
997733878 5:136199560-136199582 CAGCGGTCTGGGCCAGCCTGCGG + Intergenic
997888290 5:137651270-137651292 GAGCCCTAAATGCCTGCCTGAGG + Intronic
998160960 5:139812822-139812844 CAGCCCTCTAGGCCGGGCTGGGG + Intronic
998351137 5:141502108-141502130 GAGCTCTGTGGGCCTGGCTGAGG - Intronic
999759307 5:154688155-154688177 GAGCTCTATGTGCCAGCCTGTGG + Intergenic
1001480648 5:172086886-172086908 GTGCTCTCTGGCCCTGGCTGTGG - Intronic
1001955364 5:175845046-175845068 TCACCATCTGGGCCTGCCTGGGG - Intronic
1002204358 5:177553061-177553083 CAGCCCTCTGTGCCTCCCTCTGG - Intronic
1002521441 5:179795070-179795092 GGGCCCTCTGACCCTGCCTCAGG - Intronic
1002887746 6:1311731-1311753 GAGCCCTCGCGGGCTGCCCGGGG + Intergenic
1003123960 6:3340398-3340420 CAGCCCTGTGGGCTGGCCTGGGG + Intronic
1004387757 6:15187222-15187244 GAGCCATCGTGCCCTGCCTGGGG - Intergenic
1006151374 6:31991959-31991981 GAGCCCTCTGGGTGGGGCTGGGG + Intronic
1006157675 6:32024697-32024719 GAGCCCTCTGGGTGGGGCTGGGG + Intronic
1006303977 6:33208184-33208206 GAGCCCTCTGTCCCCTCCTGGGG + Intergenic
1006779314 6:36621389-36621411 GAGCCCTAGGAGCCTGCCTTGGG - Intergenic
1007323472 6:41043306-41043328 AAACCCTCTATGCCTGCCTGGGG + Intronic
1007378204 6:41470518-41470540 GAGCCATCTGGGCCAGCGCGGGG + Intergenic
1007531550 6:42547487-42547509 GAGCCTTCTGGGAATTCCTGAGG + Intergenic
1008447644 6:51611387-51611409 GAGCCCTCTGGACCTTGCAGAGG - Intergenic
1009240410 6:61179492-61179514 GAGCACAATGGGCCTGTCTGGGG + Intergenic
1011333160 6:86233165-86233187 GACACCTCTGGACCTGCCTGGGG - Intergenic
1011712867 6:90072348-90072370 GAGCACTGTGGTCCAGCCTGTGG - Intronic
1013301579 6:108809377-108809399 CAGCCCACTGGCCCTCCCTGCGG + Intergenic
1013719771 6:113010399-113010421 GATGCCACTGGGCCTGCCTAAGG - Intergenic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1015970056 6:138734691-138734713 GAGCCCACTGGGACTGACTGAGG + Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1018029296 6:159829567-159829589 GAGCTCTCTTGTCCTGCTTGTGG + Intergenic
1018720625 6:166569302-166569324 CAGCCCTCGGTGCCTCCCTGTGG - Intronic
1018845588 6:167553214-167553236 GAAACCACTGGACCTGCCTGGGG + Intergenic
1018937473 6:168283257-168283279 GAGCCCTCTGGGCCTCCTGTAGG + Intergenic
1019143036 6:169960211-169960233 GAGCCCTCAGGGCCTCCCAGGGG + Intergenic
1019157888 6:170051231-170051253 AAGGCCTCTGGTCCCGCCTGGGG - Intergenic
1019309864 7:354762-354784 GAGCCCACGGGGCCAGCCCGGGG + Intergenic
1020066138 7:5190084-5190106 GGGCGCGCTGGGCCTGGCTGAGG - Intergenic
1020086030 7:5311267-5311289 GAGCCCTTCCAGCCTGCCTGTGG - Intronic
1020313865 7:6890462-6890484 GGCTCCTCTGGGCTTGCCTGTGG - Intergenic
1020488682 7:8751207-8751229 AAGACCTCTGGGACTGGCTGAGG + Exonic
1021585136 7:22199620-22199642 GAGCCCTTTGTGGCTCCCTGGGG - Intronic
1022874331 7:34513120-34513142 GAGAGCCCTGGGCCTGCCTCAGG + Intergenic
1022902365 7:34823835-34823857 GAGCCCTCTGGGGGTCACTGTGG - Intronic
1023881371 7:44323450-44323472 GAGGTCTTTGGGGCTGCCTGGGG - Intronic
1024517029 7:50267853-50267875 GACACCTTTAGGCCTGCCTGAGG + Intergenic
1026024252 7:66732302-66732324 GAGGCCTCTGGGGCTGCCTCTGG + Intronic
1026063333 7:67046262-67046284 GAGCCCTTTGGTTCTGCTTGTGG + Intronic
1026715010 7:72781235-72781257 GAGCCCTTTGGTTCTGCTTGTGG - Intronic
1026888984 7:73971194-73971216 GAGGCCTCTGGGGCTGCCTCTGG + Intergenic
1028621855 7:92835175-92835197 GAGCCCCCAGGGACTGCCCGGGG + Intronic
1029791145 7:102844441-102844463 GAGCTCCCTTAGCCTGCCTGCGG + Intronic
1030008865 7:105145869-105145891 GAGGCTCCTGGGACTGCCTGGGG - Intronic
1030278421 7:107744211-107744233 AAGCCCCCTTGGCCGGCCTGGGG + Intronic
1032265254 7:130366012-130366034 GCGCTCCCTGGGCCTCCCTGGGG + Intronic
1033290632 7:140079733-140079755 GTCCACTCTGGGGCTGCCTGTGG + Intergenic
1034781813 7:153888052-153888074 GAGCCCTGGGGGTCTGCTTGGGG - Intronic
1034938238 7:155213537-155213559 GGGGCCTCTGGGCCTCCATGAGG - Intergenic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1035219803 7:157399579-157399601 GTGCCCTCTAGGCCTGAGTGCGG + Intronic
1035328088 7:158077701-158077723 GTGGCCTGTGGGGCTGCCTGTGG - Intronic
1035425061 7:158765148-158765170 GCGCGCTCTGGGGCTGCGTGGGG - Intronic
1036655141 8:10672919-10672941 GCTCCTTCTGGGCCTGCATGTGG - Intronic
1036802530 8:11802969-11802991 GAGCTCGCTGGGCCGGCCTCAGG + Intronic
1037313079 8:17576823-17576845 GAGCACTCAGGTTCTGCCTGAGG + Intronic
1037846059 8:22283205-22283227 TCGCCCTCTGGTCCTGACTGTGG + Exonic
1039833118 8:41233543-41233565 GAGTCCTCAGGGACTGGCTGGGG - Intergenic
1041208891 8:55526281-55526303 GAGCCCTCTGTTACTTCCTGTGG - Exonic
1041209727 8:55536775-55536797 GGGCATTCTGGGCCTGGCTGCGG + Exonic
1042176933 8:66046330-66046352 GATCCCACTGCGCCTTCCTGTGG + Intronic
1048011062 8:130456671-130456693 GAGTCCCCTGGGTCTGCCTGGGG - Intergenic
1048018816 8:130520021-130520043 GAGTCCTCTCTGCATGCCTGGGG + Intergenic
1048094192 8:131273684-131273706 GAGTACTGTGGTCCTGCCTGAGG - Intergenic
1048113862 8:131498112-131498134 GAGTCCTCATGGCTTGCCTGGGG + Intergenic
1048290838 8:133180676-133180698 GTGTCCTCTGGACCTTCCTGGGG - Intergenic
1048986351 8:139737190-139737212 TGTCCCTCAGGGCCTGCCTGGGG - Intronic
1049157385 8:141075346-141075368 GAGCCTTCTGGGGCTGCCCCTGG + Intergenic
1049384231 8:142333070-142333092 GGGGCCTCTGGGCCAGGCTGGGG + Intronic
1049494205 8:142922174-142922196 GAGCCCAGTGGCCCAGCCTGAGG + Intergenic
1049661031 8:143819841-143819863 GAGAGCTCTTGGCCTGCCTGGGG - Intronic
1050030224 9:1378240-1378262 GAGCCTTCTGGGCCTGCAGAGGG + Intergenic
1052812878 9:33076778-33076800 GAGCCCTCAGGGGCTGTCAGAGG + Intergenic
1052977359 9:34421155-34421177 GAGGCCTGGGGGCCAGCCTGGGG + Intronic
1053786806 9:41658149-41658171 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1054158255 9:61656046-61656068 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1054452751 9:65412135-65412157 GAGGACTCTGGTCCTACCTGGGG + Intergenic
1054478028 9:65587051-65587073 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1055623705 9:78150847-78150869 CAGCTCTCTGAGCCTTCCTGTGG - Intergenic
1059289340 9:113208720-113208742 GAGCCATCTCGTCCAGCCTGAGG - Intronic
1060555857 9:124506918-124506940 GAGGGCTCTGGGCCTGTCTTGGG - Intronic
1061666818 9:132164839-132164861 GAGCCCTGGGGCCCTGGCTGGGG + Intronic
1061744890 9:132732465-132732487 GTGACCTCTGGGCCTCCCTCAGG - Intronic
1061922332 9:133788954-133788976 GACCACTCTGGGCCTGTCTTGGG + Intronic
1062645113 9:137543887-137543909 CAGTCCTCAGGACCTGCCTGTGG + Intronic
1062737245 9:138144233-138144255 GACCTCTCTGTGCCTTCCTGAGG + Intergenic
1186456964 X:9717355-9717377 GCTCCCTCAGGCCCTGCCTGTGG - Exonic
1186563428 X:10637341-10637363 CAGTTCTCTGGGCCTGCCAGAGG + Intronic
1187932992 X:24311241-24311263 GAACCCTGTGGCCCTGGCTGAGG + Intergenic
1187939219 X:24364921-24364943 GAACCCTGTGGCCCTGGCTGAGG - Intergenic
1189731399 X:44024794-44024816 GGGCCCTCTGGGCCTGTATTAGG - Intergenic
1190257349 X:48773500-48773522 GAGATCTCTGGGCCTGGGTGGGG - Exonic
1190537691 X:51446218-51446240 GGCACCTCTGGACCTGCCTGAGG - Intergenic
1192172382 X:68865117-68865139 GGGGCCTCCTGGCCTGCCTGAGG - Intergenic
1192204458 X:69086806-69086828 TAGCCCTGTGAGCCTGGCTGAGG + Intergenic
1192247787 X:69387893-69387915 GCCCCCTCTGGGCCTGTCTCCGG + Intergenic
1192317257 X:70062671-70062693 GAGCCATCTCGGCCTCCATGCGG - Exonic
1193742414 X:85232833-85232855 GACATCTCTGGACCTGCCTGTGG + Intergenic
1194253249 X:91603618-91603640 GGCAACTCTGGGCCTGCCTGAGG + Intergenic
1195129123 X:101837495-101837517 TGGCTCTCTGGGCCTGCCCGAGG + Exonic
1195202947 X:102567041-102567063 CAGCTCTCTGGGCCTGACTGAGG - Intergenic
1195502166 X:105613877-105613899 GACACCTCTGGGCATGCATGGGG + Intronic
1196237818 X:113303285-113303307 AAGCCCTCTGTGGCTTCCTGTGG + Intergenic
1196466246 X:115973892-115973914 CAGCACTCTGGGCCCTCCTGGGG + Intergenic
1200162981 X:154018771-154018793 GAGCTCTCTGGGCCTGGCTGTGG + Exonic
1200954661 Y:8931153-8931175 CAGGCCTCATGGCCTGCCTGAGG - Intergenic