ID: 947710903

View in Genome Browser
Species Human (GRCh38)
Location 2:232315146-232315168
Sequence CAGGTCCCTGTTTGATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947710899_947710903 20 Left 947710899 2:232315103-232315125 CCAAGACTTCAAGGAGTTCTAGA 0: 1
1: 0
2: 2
3: 14
4: 174
Right 947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 112
947710896_947710903 26 Left 947710896 2:232315097-232315119 CCCTTCCCAAGACTTCAAGGAGT 0: 1
1: 0
2: 0
3: 16
4: 188
Right 947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 112
947710895_947710903 27 Left 947710895 2:232315096-232315118 CCCCTTCCCAAGACTTCAAGGAG 0: 1
1: 0
2: 0
3: 13
4: 226
Right 947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 112
947710897_947710903 25 Left 947710897 2:232315098-232315120 CCTTCCCAAGACTTCAAGGAGTT 0: 1
1: 0
2: 0
3: 10
4: 164
Right 947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 112
947710898_947710903 21 Left 947710898 2:232315102-232315124 CCCAAGACTTCAAGGAGTTCTAG 0: 1
1: 0
2: 0
3: 11
4: 158
Right 947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG 0: 1
1: 0
2: 1
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947710903 Original CRISPR CAGGTCCCTGTTTGATGAAC AGG Intronic
900689424 1:3971346-3971368 CAGGTCCCTCATTCATGAAGGGG - Intergenic
903985474 1:27224509-27224531 CTGTTACCTGTTAGATGAACAGG - Intergenic
904083288 1:27885554-27885576 ATGGTCCCAGTTTGATGGACAGG + Intronic
904235530 1:29114269-29114291 GGGGTCCCTGTTTGAGGATCTGG - Intronic
906882673 1:49609376-49609398 CAGCTTTCTTTTTGATGAACTGG - Intronic
907359421 1:53902760-53902782 TAGGTCCCTGTGTGATTCACTGG - Intronic
910555952 1:88532888-88532910 CAGGGTCCTGCTTGATGAAATGG - Intergenic
911936634 1:103984304-103984326 CATATCTCTGTTTCATGAACTGG + Intergenic
917019283 1:170568973-170568995 CCAGTCCCTGTGAGATGAACCGG - Intergenic
918594554 1:186278114-186278136 CAGATCCATGTTTAATGAAAAGG + Intergenic
919214108 1:194529665-194529687 TAGTTCCCTGTTTGTTGAAGAGG - Intergenic
920279395 1:204831329-204831351 CAGCTCCCTGTGGGCTGAACTGG + Intronic
920461450 1:206143839-206143861 CAGTTCCCTGTTAGATGAACTGG + Intergenic
921957367 1:220998533-220998555 CTGGGCCCTGTTTTATGAGCTGG - Intergenic
924592125 1:245413950-245413972 CAGTTCCCTCTTTGGTGAAAGGG + Intronic
1063001000 10:1922828-1922850 CTGGTCTCTGATAGATGAACAGG - Intergenic
1067106652 10:43371122-43371144 CAGGTCCCTCTTTTAGGATCTGG + Intergenic
1071100929 10:82036873-82036895 AAGGTCACTGTTTAACGAACAGG + Intronic
1071101119 10:82038812-82038834 CAGAAACCAGTTTGATGAACTGG - Intronic
1071241524 10:83711141-83711163 CAGGACTCTGTTTAATGATCTGG - Intergenic
1072508807 10:96097508-96097530 CAGGTCCATGTTTACTGATCAGG - Intergenic
1074529048 10:114284616-114284638 TAAGGCCCTGTGTGATGAACTGG - Intronic
1076046710 10:127300102-127300124 CAGGTCAGTGTTTGCTGAGCAGG - Intronic
1081252446 11:40851477-40851499 CTGGTCCCAGTGAGATGAACTGG + Intronic
1081460040 11:43264187-43264209 CAGGTCACTGCATCATGAACTGG - Intergenic
1081819307 11:45976238-45976260 CAGGGCCCTGTCAGATGAATGGG - Intronic
1084487074 11:69454746-69454768 CAGGCCCGTGTTACATGAACGGG + Intergenic
1086992739 11:93323321-93323343 CAGGTCTCTCTGTGATGACCAGG - Intergenic
1095633072 12:44400567-44400589 CAGTTCTCTCTTTGATCAACGGG - Intergenic
1095920710 12:47526916-47526938 CAAGTCCCAGTGAGATGAACTGG + Intergenic
1097503693 12:60438275-60438297 CAGGTCCTTGTTTGGTGTCCAGG + Intergenic
1097691814 12:62740838-62740860 CAGGGCCCTGTGTGGTGCACAGG + Intronic
1099239022 12:80116391-80116413 CAAGTCCCAGTGAGATGAACTGG + Intergenic
1101613828 12:106316775-106316797 TAGGGCCCTGTTTTAGGAACTGG - Intronic
1102202842 12:111069420-111069442 CTGGGCCCTGATGGATGAACAGG - Intronic
1104614090 12:130254158-130254180 GAGGTCCCTGGTGGATGAACAGG - Intergenic
1118087027 14:62429425-62429447 TAGGTCCCTGTTAGATGCTCTGG + Intergenic
1127733542 15:61821146-61821168 CAGCTCCCACTGTGATGAACTGG - Intergenic
1127857736 15:62966582-62966604 CAGGTCTGTTTCTGATGAACAGG - Intergenic
1132387018 15:101407896-101407918 CAGGTCTCTCTTTGATAATCGGG + Intronic
1133639940 16:7707098-7707120 CAGGTCCTTGTTTGAGGATCAGG + Intronic
1138824416 16:60301852-60301874 CAAGTGACTGTTTGATGAATTGG - Intergenic
1143503064 17:7350136-7350158 CAGCTCCCCGTTTCAGGAACAGG - Exonic
1143902040 17:10181799-10181821 CTGGATCCTGTTTGATCAACGGG - Intronic
1145238022 17:21222710-21222732 CAGGGCCCTGTTTGAGCAACAGG - Intergenic
1147252593 17:39162139-39162161 CAGCTTTCTGTTTGATGCACTGG - Intronic
1149375300 17:56038047-56038069 CAGATTCCTGTCTGCTGAACAGG + Intergenic
1156283951 18:35672240-35672262 CAGGTCCCTGTTTGATTCTCAGG + Intronic
1157803345 18:50638873-50638895 CAGTTCCCTGTCTGAAGAACAGG - Intronic
1159667148 18:71175580-71175602 CAGGCCTCTGTTTGCTGAATTGG - Intergenic
1162706680 19:12560331-12560353 CACTTCTCTGTTTGATGAAGAGG + Intronic
1164047635 19:21555977-21555999 CCAGTCCCAGTTGGATGAACTGG + Intronic
1164323799 19:24174710-24174732 CAGGTGATTGTTTGATGAATGGG - Intergenic
1168506221 19:56937299-56937321 CTCGTCCCTCTTTGATGGACTGG + Intergenic
926785267 2:16511762-16511784 CACATCCCTGTGTGATGAATGGG + Intergenic
927180860 2:20446222-20446244 CAGTTCTCTGTTTTAAGAACCGG + Intergenic
929250971 2:39754731-39754753 CAGTACCCTGTTTAATGAAGGGG - Intronic
931038933 2:58275330-58275352 CAGGTCCCTTCTTGATAAGCTGG - Intergenic
931570279 2:63661829-63661851 CTGTTCCTTGATTGATGAACAGG + Intronic
931719195 2:65055325-65055347 CAGACGCCTGTTTTATGAACTGG + Intergenic
932563417 2:72891267-72891289 CAGGTCCCTGTTTTATGTCGGGG - Intronic
933870006 2:86556915-86556937 CAGGTACTTGTTTCATGGACAGG - Intronic
935638369 2:105268084-105268106 TCGGTCCCTGTCTGATCAACAGG + Intronic
935744524 2:106178981-106179003 CAGGTCCCTGTGGGCTGGACGGG + Intronic
935859085 2:107308302-107308324 TAGTTCCCTGTCTGATGAATTGG + Intergenic
947710903 2:232315146-232315168 CAGGTCCCTGTTTGATGAACAGG + Intronic
948291508 2:236828457-236828479 AAGCTTCCTGTTTGGTGAACAGG + Intergenic
1177101840 21:16907608-16907630 CAGGTATCCCTTTGATGAACTGG - Intergenic
1178532837 21:33389645-33389667 CAGGTCCCTGGGTGTTGGACTGG + Intergenic
1179127162 21:38600445-38600467 CCGGTCCCTGTTTGCTCCACAGG + Intronic
1182273906 22:29172564-29172586 CAGATCCCTGCTTGATGCCCAGG - Intergenic
1184766611 22:46575839-46575861 CAGGTTCCTGTCTGCAGAACTGG - Intergenic
950594368 3:13965753-13965775 CAGGTTGATGTTTGATGCACTGG + Intronic
952548823 3:34452050-34452072 CAGGTATCTCTTTGATGTACTGG + Intergenic
961504185 3:127359359-127359381 CAGGACCCTGCCTGAGGAACTGG + Intergenic
962452875 3:135535605-135535627 CTGGTCACTGTCTGATAAACTGG + Intergenic
967181598 3:186909890-186909912 CCAGTCCCTGTGAGATGAACTGG + Intergenic
968593082 4:1469345-1469367 CTGGCCCCTGTTTGATGACATGG + Intergenic
969863340 4:10055049-10055071 CAGGAACCTTTTTGATGAACTGG - Intergenic
984327357 4:178271195-178271217 CAGGTTCTTGTTTCATGACCAGG - Intergenic
988021373 5:25626758-25626780 CAAGTCCCAGTGAGATGAACTGG - Intergenic
990176959 5:53118728-53118750 CAGGTTCTTGTTTCATGACCAGG + Intergenic
991694289 5:69255563-69255585 TAGGTTCTTGTTTGATAAACTGG - Intronic
994005257 5:94829309-94829331 CAAGTCCCAGTGAGATGAACCGG + Intronic
994436827 5:99746198-99746220 CAGGTATCTCTTTGATGTACTGG + Intergenic
994795661 5:104295893-104295915 CAGCTCCATGTGAGATGAACAGG - Intergenic
997810656 5:136964718-136964740 AAGGTCCCTATTTTAAGAACTGG + Intergenic
998934098 5:147216106-147216128 CAAGTCCCAGTGAGATGAACTGG - Intergenic
999204961 5:149841232-149841254 CTGGGCCCTGATTGATGAAAAGG + Intronic
1000417574 5:160998589-160998611 CTGGTCCCAGTGAGATGAACTGG + Intergenic
1001019105 5:168167689-168167711 CATGTCCCTGGTTTCTGAACAGG + Intronic
1003952266 6:11127356-11127378 CAGTTCTCTGTTTGAGGAAAGGG - Intronic
1004079342 6:12375978-12376000 CATGTCCCTTTTTGATGACTGGG - Intergenic
1006828363 6:36953703-36953725 CAGCTTCCTGCTTCATGAACCGG + Intronic
1013920249 6:115394938-115394960 CCAGTCCCAGTGTGATGAACTGG + Intergenic
1019434564 7:1015377-1015399 CAAGTCCCTGTCTCATGAACAGG + Intronic
1026741664 7:72982646-72982668 CAGGTCCAGGCTTCATGAACTGG + Intergenic
1027102071 7:75382431-75382453 CAGGTCCAGGCTTCATGAACTGG - Intergenic
1029419356 7:100464491-100464513 CAGATTCCTCTTTGATGAAGTGG - Intronic
1032019476 7:128399021-128399043 CAGGTCCCTGTTGGCTATACTGG - Intronic
1033096561 7:138437265-138437287 CAGGTACCTGTTTGTTGATGTGG - Intergenic
1033251728 7:139766460-139766482 CTTGACCCTGTTTGATGAACAGG + Intronic
1033797185 7:144860167-144860189 CATGTCCCTAGTTGATGAAGAGG + Intergenic
1034234525 7:149556309-149556331 AACTTCCCTGTTTCATGAACTGG + Intergenic
1034827959 7:154284052-154284074 TACTTCCCTGTTTGATAAACGGG + Intronic
1037522522 8:19693691-19693713 CAGGGCACAGTTGGATGAACTGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041542306 8:58999235-58999257 CAGGTTCCTTTTTAATGAACTGG - Intronic
1042084079 8:65088843-65088865 CAGGTCCGAGTTTTATGCACAGG + Intergenic
1050188368 9:2998780-2998802 CAGCTCCCTGTTGGATACACAGG + Intergenic
1052498123 9:29254329-29254351 CAGTTGCCTGATTGCTGAACTGG + Intergenic
1053433161 9:38057511-38057533 CTGGTCCCTTTCTGAGGAACCGG + Intronic
1055393865 9:75852323-75852345 AAGATCCGTGTTTGATGGACAGG - Intergenic
1061175633 9:128994781-128994803 CTGTTCCCTGTTTGATATACTGG + Intronic
1061601637 9:131674443-131674465 CAGATCTCTGTGTTATGAACAGG + Intronic
1062605976 9:137349035-137349057 CAGGTCCTTGGTTTATGGACAGG + Intronic
1192083482 X:68070991-68071013 CACTTCTCTGTTTGATGAAGAGG - Intronic
1192916135 X:75652787-75652809 CCAGTCCCAGTTGGATGAACTGG + Intergenic
1193150862 X:78123200-78123222 CACTTCTCTGTTTGATGAAGAGG + Exonic
1193857432 X:86622082-86622104 CAGATCCCTGTTTTCTAAACTGG - Intronic
1197184654 X:123573310-123573332 CCAGTCCCTGTGAGATGAACTGG - Intergenic
1198060657 X:133042536-133042558 CCAGTCCCTGTGAGATGAACTGG + Intronic
1199021371 X:142882071-142882093 CAGGTAACTGTCTGATCAACTGG - Intergenic