ID: 947711585

View in Genome Browser
Species Human (GRCh38)
Location 2:232319494-232319516
Sequence CACCCCAGGAGGGCCCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 328}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947711585_947711592 -1 Left 947711585 2:232319494-232319516 CCACACAGGGCCCTCCTGGGGTG 0: 1
1: 0
2: 6
3: 38
4: 328
Right 947711592 2:232319516-232319538 GTTGGGCAAGGCCTCCTCCCAGG 0: 1
1: 0
2: 1
3: 24
4: 209
947711585_947711593 5 Left 947711585 2:232319494-232319516 CCACACAGGGCCCTCCTGGGGTG 0: 1
1: 0
2: 6
3: 38
4: 328
Right 947711593 2:232319522-232319544 CAAGGCCTCCTCCCAGGCAGAGG 0: 1
1: 0
2: 2
3: 43
4: 324
947711585_947711595 12 Left 947711585 2:232319494-232319516 CCACACAGGGCCCTCCTGGGGTG 0: 1
1: 0
2: 6
3: 38
4: 328
Right 947711595 2:232319529-232319551 TCCTCCCAGGCAGAGGCAGCTGG 0: 1
1: 0
2: 1
3: 78
4: 700
947711585_947711599 19 Left 947711585 2:232319494-232319516 CCACACAGGGCCCTCCTGGGGTG 0: 1
1: 0
2: 6
3: 38
4: 328
Right 947711599 2:232319536-232319558 AGGCAGAGGCAGCTGGACTGAGG 0: 1
1: 1
2: 6
3: 90
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947711585 Original CRISPR CACCCCAGGAGGGCCCTGTG TGG (reversed) Intronic
900121917 1:1051881-1051903 CACACCAGGAGGGCCCAGGAGGG + Intronic
900320553 1:2081471-2081493 ACCCCCAGAAGGGGCCTGTGTGG + Intronic
900637694 1:3674057-3674079 CACCCCACGACGGCCCAGTGAGG - Intronic
900739681 1:4323101-4323123 CAGCCCAGGAGGCCACTTTGAGG - Intergenic
900752413 1:4407016-4407038 CACCCCAGCAGGGCCCCAAGGGG + Intergenic
902149207 1:14429247-14429269 AGACCCAGGAGGGCCCTGTGGGG - Intergenic
902243420 1:15103350-15103372 CGCTCCTGGAGGGCCTTGTGGGG - Exonic
902256593 1:15193114-15193136 CTCCCCAGAGGGGCCCTCTGCGG - Intronic
902451173 1:16498164-16498186 CCACCCAGGTGGCCCCTGTGGGG - Intergenic
902506888 1:16944335-16944357 AACCCCAGGGGGGCACTGTCAGG - Intronic
903189496 1:21648888-21648910 CTTCCCAGGAGGGCTCTGCGGGG + Intronic
904334102 1:29785819-29785841 CTCCCCAGCAGGGGCCTGAGAGG - Intergenic
904547426 1:31286658-31286680 CACCCCATTAGGGCACTGTTGGG + Intronic
905024481 1:34840347-34840369 CACCCCAGTGTGGCCTTGTGCGG + Intronic
912260125 1:108102864-108102886 AACCCCCTGAGAGCCCTGTGTGG - Intergenic
912554076 1:110503643-110503665 CACCCCAGGAGGCCCCCATTTGG - Intergenic
916424572 1:164668492-164668514 CAGCCCAGCAGGGCCCTGGCTGG - Intronic
917965951 1:180178650-180178672 CTCCCTTGGAGGGCCCTGTGTGG + Intronic
918124184 1:181568297-181568319 CGCCCCAGGAATGGCCTGTGGGG + Intronic
918132312 1:181640231-181640253 CACTCCAAGATGGCCCTATGAGG - Intronic
919899756 1:202035079-202035101 CACCCCAGGACGGGCCTTTGAGG - Intergenic
921041773 1:211439698-211439720 CAACCCAGGAGGTGCCTTTGAGG - Intergenic
921100609 1:211925286-211925308 CACCCCAGAAGGCAGCTGTGTGG + Intergenic
922617925 1:226974107-226974129 GCCCACAGGAGGGCCCTGTTTGG + Intronic
922765002 1:228152046-228152068 CTCCACTGCAGGGCCCTGTGTGG - Intronic
922796367 1:228341676-228341698 CACCCAGGCAGGGACCTGTGCGG - Intronic
1062855384 10:777458-777480 CACGCCAGGGGAGGCCTGTGGGG - Intergenic
1062933430 10:1367994-1368016 CACACCAGCTGGGCCCTCTGGGG + Intronic
1062957678 10:1551153-1551175 CACAGAAGGAGGACCCTGTGAGG + Intronic
1062957824 10:1551960-1551982 CACCCCAGGGGGGCGGAGTGAGG + Intronic
1063447450 10:6128285-6128307 CATCCAAGCAGGGCCCTGGGCGG - Intergenic
1064229599 10:13518321-13518343 CTGCCCAAGGGGGCCCTGTGAGG - Intronic
1065697608 10:28394195-28394217 AACCCCAGGTGGGCTCTGCGTGG - Intergenic
1065918065 10:30368609-30368631 GCCCCCAGCAGGGCCCTCTGAGG - Intronic
1065988928 10:30987713-30987735 CACCCAGGAAGGGCCATGTGAGG + Intronic
1067054782 10:43044242-43044264 CTCCCCAGAAGTGCCCTGTGAGG + Intergenic
1067054797 10:43044290-43044312 CTCCTCAGAAGTGCCCTGTGAGG + Intergenic
1067069835 10:43123608-43123630 GCCCCCCGGAGGGCTCTGTGAGG + Intronic
1067296245 10:44976677-44976699 CATGCCATGAGGCCCCTGTGTGG + Exonic
1067693674 10:48520382-48520404 CAGCCCAGGAGGGGCCTAAGGGG + Intronic
1069535255 10:69248322-69248344 CAGTCCCGGAGGGCCCTGCGGGG - Intronic
1069784900 10:70981605-70981627 CCTGCCAGGAGGGGCCTGTGGGG - Intergenic
1069913520 10:71773590-71773612 CGCCCCCGGGGGGCCGTGTGGGG + Intronic
1069994437 10:72333788-72333810 CACCCAAGCAGGTCCTTGTGGGG + Exonic
1070804786 10:79264676-79264698 CACCTCCGGAGGGGCTTGTGAGG + Intronic
1070888942 10:79927908-79927930 CACCTCATGAGGGGCCTGTAAGG - Intergenic
1071274744 10:84043185-84043207 CACCAGAGGAGGGTGCTGTGTGG - Intergenic
1071563613 10:86660577-86660599 CCCCACAGTAGGGCCCTGGGGGG - Intronic
1073472408 10:103731089-103731111 CACCTCAGCTGGGCCCTGTGTGG - Intronic
1075816039 10:125265475-125265497 CACCCCAGGTGGGTCCTGTGAGG + Intergenic
1076745276 10:132509808-132509830 AAGCTCAGGAGGGCCCTGTGTGG - Intergenic
1077130488 11:969818-969840 CATCACAGCAGGGCCCTCTGTGG + Intronic
1077500647 11:2908422-2908444 CATCCCAGGGGGGTCCGGTGTGG - Intronic
1077517567 11:3010961-3010983 CTCCCCAGGGGGCCTCTGTGTGG - Intronic
1077603579 11:3591559-3591581 CTCCCCAGAAGGGCCCGATGTGG - Intergenic
1078551226 11:12281667-12281689 CATCCCAGGATGACCCTGTGGGG + Intronic
1079250435 11:18783121-18783143 GGCCCCAGGAGGTCCCTCTGAGG + Intronic
1081616789 11:44596093-44596115 CCCTCCTGGAGGACCCTGTGAGG + Intronic
1081695400 11:45105870-45105892 CACCCCTGGAGAGGCCTCTGTGG - Intronic
1082087441 11:48061684-48061706 CACCCCAGAGGGGCCTTGAGAGG + Intronic
1082097300 11:48141362-48141384 CATCCATGGAGGGTCCTGTGGGG + Intronic
1083321702 11:61851636-61851658 CACCACAGCAGGGCCAGGTGGGG + Intronic
1083820756 11:65170146-65170168 CCCCCCAGGAAGGCCCTGATTGG + Exonic
1084448860 11:69220796-69220818 CAGCCCACGAGGGCTCTGGGTGG - Intergenic
1084672676 11:70616461-70616483 CGCCCGAGGAGGGCGCTGGGTGG + Intronic
1084945116 11:72634193-72634215 CACGACAGGAGGGCCCGGGGAGG + Intronic
1085291054 11:75399742-75399764 CCAGCCAGGAGGGCGCTGTGTGG + Intronic
1086890754 11:92255213-92255235 AACCCAGGGAGGGGCCTGTGAGG - Intergenic
1087826607 11:102771602-102771624 CACCCCAGGGGAGCCTTGTCTGG - Intronic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089363166 11:117904243-117904265 CACCCAAGGGAGGCCCTCTGTGG + Intronic
1089365231 11:117917355-117917377 TGGCCCAGGAGGGCCCCGTGAGG + Intronic
1089614538 11:119687801-119687823 CATCCCAGGAGGGGCCTGTGGGG + Intronic
1090554825 11:127862935-127862957 CCCCCCAGCAGGCCCCAGTGTGG + Intergenic
1090808345 11:130216857-130216879 CACCCCAGAAGGCCCCAGAGAGG - Intergenic
1091086614 11:132727431-132727453 CTCCCCAGGAGAGCCCTGGCTGG - Intronic
1091192203 11:133705467-133705489 CACCCCAAGAGGTGGCTGTGGGG - Intergenic
1092209202 12:6635565-6635587 CTCCCAGGGAGGGCCCTCTGGGG - Intronic
1094016844 12:25874061-25874083 CACTTCAGGAGGGACCAGTGTGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG + Intronic
1096606488 12:52769975-52769997 CACCCCAGGAGGGCCCATTGTGG - Intronic
1097003607 12:55899391-55899413 CACCCCAAGATGGCATTGTGGGG - Intergenic
1097178307 12:57156357-57156379 CCCCACAGGAGGGCCCAGAGAGG - Intronic
1101907690 12:108839933-108839955 GGCCTCAGGAGGGCCCTGAGAGG + Intronic
1102305280 12:111800042-111800064 CCCTCCAGGCGGGCACTGTGTGG + Exonic
1103936812 12:124481395-124481417 CACCCCAGGAGGACGTGGTGGGG + Intronic
1105068358 12:133218840-133218862 CACCCCAGGAGGAGCGGGTGTGG - Exonic
1107503588 13:41007183-41007205 CACCTCAGAAACGCCCTGTGTGG + Intronic
1110119464 13:71865329-71865351 CACCCGAGGAGGGCACTTTGAGG - Intronic
1113842218 13:113366554-113366576 CACACCAGGGGGCCTCTGTGGGG + Intergenic
1113890216 13:113731635-113731657 CAGCCTCTGAGGGCCCTGTGGGG + Intronic
1114266563 14:21075684-21075706 CTCCTCAGGAGGGCACGGTGGGG - Exonic
1116480200 14:45387948-45387970 CACTCTAGGAGTGCCTTGTGGGG - Intergenic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1118990338 14:70791822-70791844 CTCTCCAGGAGCTCCCTGTGGGG - Intronic
1119369632 14:74128342-74128364 TACTCCAGGAGGACCCTCTGTGG - Intronic
1119876543 14:78064574-78064596 CTCCCCAGAATAGCCCTGTGTGG - Intergenic
1119933671 14:78570986-78571008 CAGCCCCGCTGGGCCCTGTGGGG + Intronic
1121557148 14:94847012-94847034 CAGCCCCGGTGGCCCCTGTGCGG - Intergenic
1121952927 14:98187673-98187695 CAACCCAGGAGTCCACTGTGGGG + Intergenic
1202843379 14_GL000009v2_random:144833-144855 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1202912775 14_GL000194v1_random:135071-135093 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1202879867 14_KI270722v1_random:47609-47631 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1124139415 15:27064172-27064194 CTCCCCAGGAGGGCGCAGGGTGG + Intronic
1124154255 15:27211172-27211194 CACTCCTGGAGGGCCTTGGGTGG - Intronic
1124624666 15:31301069-31301091 CACGTCTGGAGGGCCCTGTGTGG + Intergenic
1124695799 15:31863312-31863334 TGCCCCAGGAGGGACTTGTGTGG + Intronic
1126386701 15:48100702-48100724 CTCCCCAGCAGTGCCCTGGGAGG - Intergenic
1127933366 15:63612604-63612626 CACCCACCAAGGGCCCTGTGGGG + Intronic
1130303725 15:82699333-82699355 CACTCCAGTGGGGGCCTGTGGGG + Intronic
1130542739 15:84833634-84833656 CAGCCCACCAGGGCCCTGTCAGG + Intronic
1131323811 15:91423002-91423024 CACCCCAGGAGGGAGGTTTGAGG + Intergenic
1132505809 16:308094-308116 CACCACACAAGGGCCCTCTGGGG + Intronic
1132537900 16:492411-492433 CTCCCGGGGAGGGCCCTGGGCGG - Intronic
1132592319 16:731402-731424 CCCGCCAGGAGGGCCCTGCCTGG + Intronic
1132686566 16:1164726-1164748 AACCCCAGGAGGCCCCTCTGCGG - Intronic
1132863196 16:2081514-2081536 CAGGCCAGGAGGCCCCTGGGGGG + Intronic
1132911805 16:2317577-2317599 CACCCCAGGAGGGCCCTCTTGGG - Intronic
1133139553 16:3734269-3734291 CACCCCAGGAGCTCGCTCTGGGG - Intronic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1133905795 16:10021315-10021337 CCCTCCTGGATGGCCCTGTGAGG + Intronic
1136115476 16:28091711-28091733 CTCCCCAGGCAGGCTCTGTGAGG + Intergenic
1137054397 16:35736350-35736372 CAGCCCAGGACCTCCCTGTGAGG + Intergenic
1137403400 16:48171406-48171428 CTCCACATGAGGGCCCTGGGGGG - Intronic
1137431279 16:48419924-48419946 TACAGCAGGAGGGCCCTGTCTGG + Intronic
1137587007 16:49669738-49669760 CAGCCCAGCTGGGCTCTGTGTGG - Intronic
1138335096 16:56246653-56246675 CTCCACAGCAGGGCGCTGTGGGG - Intronic
1138543711 16:57704125-57704147 CTCCCCACGATGGCCCAGTGTGG + Intronic
1138648127 16:58440018-58440040 CACCCCCTGAGGGGCCTTTGAGG + Intergenic
1139798185 16:69499806-69499828 GTCCCCAGGAGGGGGCTGTGTGG + Intergenic
1139820218 16:69715154-69715176 CTCCCCATGATGGCACTGTGTGG + Intronic
1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG + Intronic
1141680063 16:85538638-85538660 CACCTTCGGAGGCCCCTGTGGGG + Intergenic
1141702534 16:85649060-85649082 CAACCCAGGAGAGGCCTCTGGGG - Intronic
1141886900 16:86898563-86898585 CCCCTCAGGAGGGACTTGTGAGG - Intergenic
1141893750 16:86945258-86945280 CACCCCATGGGGGCCATGTCGGG + Intergenic
1142005552 16:87688006-87688028 CTCCCCGTGAGGGTCCTGTGTGG - Intronic
1142053038 16:87972897-87972919 CAGCCCTGCAGGCCCCTGTGTGG + Intronic
1142608602 17:1095953-1095975 CACCCCAGGAGGGCCAGTCGTGG + Intronic
1142740183 17:1927356-1927378 CTCCCCAAGGGGTCCCTGTGAGG + Intergenic
1143784322 17:9245380-9245402 CACCACAGTCGGGCCCTGTGAGG + Intergenic
1145810601 17:27761748-27761770 AAGCCCAGGAGGGCCCACTGAGG - Intronic
1147332703 17:39708254-39708276 AACCCCAGGGAGGCCCTGGGGGG + Intronic
1147556251 17:41481028-41481050 GAGCCCAGGAGGGGCCAGTGGGG - Exonic
1147777525 17:42913091-42913113 CAGGCAAGGAGGGCCCGGTGCGG - Exonic
1148238044 17:45982574-45982596 CACACCAGAAGGGCCCTCGGAGG + Intronic
1150142088 17:62738814-62738836 AAACCCAGGAGGGGCCTGAGAGG - Intronic
1150248050 17:63690726-63690748 CAGCCCAGGAAGGAGCTGTGGGG + Intronic
1151757359 17:76082455-76082477 CTCCTCTGGAGGGCTCTGTGGGG - Exonic
1151967104 17:77437184-77437206 CACCCCAGTGGGGCCCTGCGAGG + Intronic
1152701470 17:81821913-81821935 CCCACCAGGAGGCGCCTGTGGGG + Intergenic
1152722596 17:81930176-81930198 CACCCTGGGAGGGCCCTGCCTGG - Intergenic
1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG + Intergenic
1154050665 18:10953780-10953802 CACCCCGGTGTGGCCCTGTGTGG - Intronic
1154152513 18:11917574-11917596 CACAGCAGGACGGCACTGTGTGG + Intergenic
1155266562 18:24100336-24100358 CACCCCTGGAGGCCACTGTTGGG + Intronic
1156370404 18:36467525-36467547 CACTCCAGGAGGGTGCTGTGAGG + Intronic
1157101017 18:44729842-44729864 AACCCCAGGAGGTCCCGGGGAGG + Intronic
1157490971 18:48123502-48123524 CAGCCCCAGAGGTCCCTGTGGGG + Intronic
1157574855 18:48736743-48736765 TTCCCCAGGAGGGCCATGTGGGG - Intronic
1157598166 18:48876319-48876341 CGCCACAGGAGGGGCCAGTGAGG - Intergenic
1157711944 18:49856238-49856260 CACCCCATGAAGGTGCTGTGAGG + Intronic
1158722180 18:59935313-59935335 CACCCCAACCTGGCCCTGTGAGG - Intergenic
1160299533 18:77667615-77667637 CACCCAAGGAGGGTCCTGCCAGG - Intergenic
1160532604 18:79574298-79574320 TGTCCCAGGAGGACCCTGTGCGG + Intergenic
1160840291 19:1143719-1143741 CCTCTCATGAGGGCCCTGTGAGG + Intronic
1161380956 19:3964606-3964628 GAGCCCTGTAGGGCCCTGTGGGG - Intronic
1161399243 19:4060144-4060166 CAGCCCAGGAGGGGCCTGCCAGG - Intronic
1161572197 19:5036660-5036682 CCCCCCAGGAGCCCCGTGTGAGG + Intronic
1161739061 19:6009219-6009241 CAACCCAGGAGGGTTCTGTTTGG + Intronic
1162031247 19:7918104-7918126 CAGCCCAGGAGGTCCCAGTGAGG + Exonic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1162824831 19:13244991-13245013 CCCCTCAGGAGGGCATTGTGGGG - Intronic
1165369942 19:35398754-35398776 CAGCCCAGGAAGGCCCTCGGAGG - Intergenic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1166110917 19:40622491-40622513 CACCTAGGCAGGGCCCTGTGGGG + Exonic
1166552626 19:43676512-43676534 CTCCCCAGGGAGGCCCTGAGTGG - Intergenic
1166978637 19:46620020-46620042 CACCCCGGCAGGGCCCAGGGTGG + Intergenic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
1167424395 19:49422614-49422636 CCCCCCAGGACGGGCCTGGGCGG - Exonic
1167503754 19:49861005-49861027 CACACAGGGAGGGCGCTGTGTGG - Intergenic
1168710521 19:58497525-58497547 CACCTGAGAATGGCCCTGTGTGG - Intronic
1202655485 1_KI270708v1_random:16629-16651 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
925390912 2:3493315-3493337 CCCCCAAGGAGGGGCGTGTGAGG - Intergenic
926018570 2:9474949-9474971 CTGCCCAGGAGGGCGCTGAGGGG - Intronic
926152693 2:10433833-10433855 CATTCCAGGAGGGCCAGGTGGGG + Intergenic
926175828 2:10591359-10591381 CACCCCAGGAGGGGCCCTGGGGG + Intronic
927870353 2:26619234-26619256 CCCCCGGGGAGGGCCCTGTGGGG - Intronic
927971817 2:27310403-27310425 CACCCTATGAAGGGCCTGTGTGG + Intronic
928438092 2:31268955-31268977 CCACCCAGGAGAGACCTGTGAGG + Exonic
931665353 2:64606521-64606543 CACCCAAGGAGTGCCTTGTATGG + Intergenic
933698042 2:85235018-85235040 GAGCCCAGGAGAGCCCTGTCTGG - Intronic
936451512 2:112637010-112637032 CCCACCAGCTGGGCCCTGTGGGG + Intergenic
937087335 2:119180068-119180090 CACCACTGGAGGGCCATGTCTGG - Intergenic
937976177 2:127583349-127583371 CACCCCCGGCTGGCCCTGGGAGG - Intronic
938143180 2:128812828-128812850 CACTGCAGGATGGCCCTGTGTGG - Intergenic
938980056 2:136517891-136517913 CACACCAGGATGGCCCATTGGGG - Intergenic
939355018 2:141090041-141090063 CTCCCCATTAGGGTCCTGTGTGG + Intronic
944290113 2:197995505-197995527 CACCCCATTAGGCCCCTTTGTGG - Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
948770661 2:240249951-240249973 CCTCCCAGGCTGGCCCTGTGTGG - Intergenic
949035040 2:241812346-241812368 CCCCCAAGGAGGGCCCTGTCAGG + Intronic
1168926662 20:1587368-1587390 CATCACAGCAGGGCCCAGTGGGG + Intronic
1168930363 20:1618644-1618666 CATCACAGCAGGGCCCAGTGGGG + Intronic
1169193496 20:3671765-3671787 CTCCCCAGGGATGCCCTGTGTGG - Exonic
1169420747 20:5457267-5457289 CACACCAGGTGGGGCCTGTTGGG - Intergenic
1171190278 20:23154053-23154075 CACACAGGAAGGGCCCTGTGAGG - Intergenic
1171294887 20:24008719-24008741 CACACTACCAGGGCCCTGTGTGG - Intergenic
1172998246 20:39086671-39086693 GAACCAAGGAGGGCCATGTGAGG + Intergenic
1173372342 20:42448282-42448304 CATCCAAGGGGGGCCCTTTGAGG - Exonic
1173852693 20:46228752-46228774 CAGCCCAGGAGGGGCCTGCCTGG - Intronic
1173947190 20:46960937-46960959 CATCCCAGGAGGTGCCTGGGAGG + Intronic
1174414938 20:50360289-50360311 TACCCCAGGAGGGGCGGGTGAGG - Intergenic
1175636808 20:60591328-60591350 CTCCCCAGGAGGTGCCTGCGTGG + Intergenic
1175840247 20:62022056-62022078 CACCCCAGGATGGACCCCTGGGG + Intronic
1175967204 20:62665677-62665699 CAGGCCAGGATGGGCCTGTGGGG - Intronic
1176014146 20:62920222-62920244 CATCCCAGCAGGGTACTGTGGGG + Intronic
1176019843 20:62957004-62957026 CGCCCCTGGAGGCCCCAGTGGGG - Intronic
1176093539 20:63329395-63329417 GAGCCCAGGAGGCGCCTGTGTGG + Intronic
1176093714 20:63330068-63330090 AGTCCCAGGAGGGGCCTGTGAGG + Intronic
1176367197 21:6040261-6040283 CACCTCAACAGGGCCCTGTCTGG - Intergenic
1176632135 21:9149751-9149773 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1176641172 21:9305072-9305094 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1179603538 21:42496774-42496796 CATCCCCGGAGGGGCCTGCGAGG - Intronic
1179756322 21:43498285-43498307 CACCTCAACAGGGCCCTGTCTGG + Intergenic
1180160453 21:45996816-45996838 CATCTCATGAGGACCCTGTGGGG - Intronic
1180176491 21:46092990-46093012 AACCTCAGCAGGGCCCTTTGTGG + Intergenic
1180219808 21:46351357-46351379 CACCCCAGCAGTGACGTGTGCGG - Intronic
1180952611 22:19727446-19727468 GACCCGATGAGGGCGCTGTGGGG + Intergenic
1180995733 22:19964382-19964404 CATTCCAGTAGAGCCCTGTGTGG + Intronic
1181031071 22:20149122-20149144 CGCCCAAGCAGGGCCCTGGGTGG + Intronic
1181358676 22:22318517-22318539 CCCCTCGGGAGGGCCCTGGGAGG - Intergenic
1182516432 22:30861719-30861741 TACCCAAAGTGGGCCCTGTGGGG - Intronic
1182837002 22:33350444-33350466 CCCCCGAGGAGGACACTGTGGGG - Intronic
1183408843 22:37643252-37643274 CACACCAGGAGGATGCTGTGGGG + Intronic
1183472995 22:38019431-38019453 CCCCCAAGGAGGTCCTTGTGAGG - Intronic
1183727482 22:39597689-39597711 CCCCACTGGAGGGCCCTCTGCGG + Intronic
1184742899 22:46439397-46439419 CCCCCCAGGAGAGCACTGTGAGG - Exonic
1184755848 22:46515259-46515281 CTCCCCAGGAGGGCCCAGGTGGG - Intronic
1184959896 22:47921333-47921355 CAGGCCTGGTGGGCCCTGTGCGG + Intergenic
949301646 3:2590999-2591021 CACTCCAGGAGGTCCCTTTGTGG + Intronic
949495552 3:4628267-4628289 CACCTCAGGAGGTCATTGTGAGG + Intronic
949681899 3:6523646-6523668 CACCCCAGGAATGCCCCATGGGG - Intergenic
949980406 3:9499136-9499158 GACCCCAGGAGGGCCTTGTTGGG - Exonic
950121671 3:10485912-10485934 CACCCCACAATGGCCCTGAGCGG + Intronic
950703478 3:14766218-14766240 CTCCCCAGGGCAGCCCTGTGCGG + Intronic
951620414 3:24595441-24595463 CATGCCAGCAGGACCCTGTGTGG + Intergenic
954116531 3:48469687-48469709 CACCCCAGGGGGTCACAGTGGGG + Intronic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
955218821 3:57007014-57007036 CGCCCCAGGAGCGCCCCCTGTGG - Intronic
956294518 3:67697193-67697215 CAGCCCTGGAAGGCCCTGGGTGG - Intergenic
956519932 3:70092978-70093000 CATCCCAGGAGAGCCCCCTGAGG - Intergenic
959974601 3:112444590-112444612 CATCCCAGAAGGACCCCGTGAGG - Intergenic
961463690 3:127068781-127068803 CACCCCAGGAAGCCCCAGTGAGG - Intergenic
961561238 3:127731761-127731783 CTCCCCTGCAGGGCCCTGCGTGG + Intronic
961819833 3:129570365-129570387 CACCCCAGGATGGCTCTGACTGG - Intronic
962754399 3:138457053-138457075 AAGCCCAGGAGGGTCGTGTGAGG - Intronic
966794255 3:183698393-183698415 CATCCCAGGGAGGCCCGGTGGGG - Intronic
966917106 3:184591070-184591092 GACCCCAGAATGGCCCTGGGAGG + Intronic
966933690 3:184691891-184691913 CATTCCGGGAGGGCCCTGTCAGG + Intergenic
967878588 3:194283016-194283038 TGCCCCAGGCAGGCCCTGTGCGG - Intergenic
1202745724 3_GL000221v1_random:99954-99976 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
968524343 4:1048381-1048403 CCCTCCAGGAGGCCCCTGTGTGG - Intergenic
968575824 4:1365713-1365735 CACCACGGGAGAACCCTGTGTGG + Intronic
968576528 4:1368882-1368904 CAGCAGAGGAGGGCGCTGTGGGG - Intronic
968788982 4:2646528-2646550 CACCACAGCAGGGAGCTGTGAGG - Intronic
968891668 4:3372574-3372596 CCCCCCAGGTGTGCCCTGTGTGG + Intronic
968944152 4:3654837-3654859 CACCCCACGAGGGTCCTGTGAGG + Intergenic
969476510 4:7425259-7425281 GACCCCAGGACTGGCCTGTGTGG + Intronic
969522645 4:7687521-7687543 CACCCCTGGAGAGCCATCTGAGG - Intronic
969627519 4:8315142-8315164 CACCACAGGAGGGCCTCCTGGGG - Intergenic
969672612 4:8598084-8598106 CACGCCCGGAGAGCGCTGTGTGG + Intronic
969735946 4:8990501-8990523 CTCCCCAGAAGGGCCCGATGGGG + Intergenic
975038118 4:69710024-69710046 CCCCCAAGTAGGGCTCTGTGTGG + Intergenic
978812111 4:112861098-112861120 GAGCCCAGGAGGTCCCTGTGAGG + Intronic
979177172 4:117679428-117679450 CACCCCAGTGGGACTCTGTGTGG - Intergenic
980884520 4:138747691-138747713 CAAGCCAGGCTGGCCCTGTGGGG + Intergenic
982067887 4:151670930-151670952 CACATCAGGAGGGTCCGGTGAGG - Exonic
1202756060 4_GL000008v2_random:63339-63361 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
990159543 5:52922519-52922541 CACTCCAGCAGGGCCCTCTGAGG + Intronic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
998104123 5:139457495-139457517 CATCCAGGGAGGGCCCAGTGAGG - Intronic
998779594 5:145641663-145641685 CCCCCCAGGGGGGCCCTGACAGG + Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1001038717 5:168316548-168316570 CAGCCCAGGAGGTCCAGGTGAGG + Intronic
1001732778 5:173972695-173972717 AACCCCAGGACTGCTCTGTGAGG - Intergenic
1002270308 5:178067424-178067446 CATCCCAGGAGGGTCCTCTGTGG - Intergenic
1002365858 5:178710309-178710331 CAGTCCAGGAGAGCCCTGTATGG - Intergenic
1002884415 6:1281137-1281159 CTCCCCTGGAGGGCCCTCTTGGG - Intergenic
1002956140 6:1866790-1866812 TACCCCGGGGGGGCACTGTGTGG - Intronic
1003308536 6:4949242-4949264 CACCCCAGCAGGCCCCTGAGAGG - Intronic
1006106358 6:31719254-31719276 CACACCAGAAGAGCCCTGTCAGG - Exonic
1006192043 6:32215371-32215393 CACCCCAGGCCAGCTCTGTGAGG - Exonic
1006428433 6:33980504-33980526 TTCCCCAGGAGGGCAGTGTGAGG - Intergenic
1006839372 6:37018577-37018599 CTTCCCAGGCTGGCCCTGTGGGG - Intronic
1007301601 6:40871926-40871948 CACCCCATGCAGGCCCTGTGGGG + Intergenic
1007750379 6:44067518-44067540 TACCCCAGTGGGTCCCTGTGAGG + Intergenic
1007866163 6:44972573-44972595 TGCCCCAGTAGGGACCTGTGTGG + Intronic
1015203017 6:130603637-130603659 CATCGCAGCAGAGCCCTGTGTGG + Intergenic
1015315071 6:131808091-131808113 CTCCCCGGGAGGGCCCGGCGGGG + Exonic
1015780520 6:136860901-136860923 CACCCCAGGTGACCACTGTGTGG + Intronic
1016356788 6:143227306-143227328 CAGCCCAGCAGGGTCCTGTGTGG + Intronic
1018172813 6:161155112-161155134 CTCCCCAGAGGGGACCTGTGGGG - Intronic
1018942857 6:168320626-168320648 CACGCCAGGAGGTCTCTGTGGGG + Intergenic
1019540592 7:1549544-1549566 CACCCCAGCCGTGTCCTGTGAGG + Intronic
1019558656 7:1645168-1645190 CACCCCAGGACACCCCTGGGTGG + Intergenic
1022127887 7:27375593-27375615 GACACTAGGAGGGCTCTGTGGGG - Intergenic
1024930618 7:54664156-54664178 CAGCCCAGGACGGCGCTGGGAGG - Intergenic
1027177309 7:75912868-75912890 CTCCCCAGGATGTCCCAGTGAGG - Intronic
1029179550 7:98690171-98690193 CACACCAGGAGGGACCCGGGAGG + Intergenic
1030108958 7:106010047-106010069 CAGCCCTGGAGGGCCAAGTGAGG + Intronic
1033653626 7:143359833-143359855 CACTCCTGGAAGGCCCTCTGAGG - Intronic
1034221406 7:149449286-149449308 CACACAAGGAGGCCTCTGTGAGG + Intronic
1034530008 7:151689712-151689734 AACCCCAGGAGAGCCCTGGTTGG - Intronic
1034919661 7:155069982-155070004 CACCCCTAGAGGGACGTGTGGGG + Intronic
1034994745 7:155570725-155570747 CACTCGCGGAGGGGCCTGTGAGG - Intergenic
1035758493 8:2051750-2051772 CACCCCAGGGCGGGCATGTGCGG + Intronic
1037473887 8:19237597-19237619 AACCGCGGGAGGGCGCTGTGCGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1039507090 8:38059970-38059992 CCTCCCAGGAAGGCCCTGAGGGG - Exonic
1039913355 8:41842121-41842143 CACCCCAGGAGGCACCAGGGTGG + Intronic
1039989611 8:42476507-42476529 AACCACAGGAGCGCCCTGGGTGG + Intronic
1040595291 8:48832299-48832321 GACCCCAGGAGGACCCTGGGAGG - Intergenic
1040607629 8:48950247-48950269 TACCCCAGGAGGTGCCTGTTGGG - Intergenic
1040834997 8:51722354-51722376 CACCCCTGGATGCCGCTGTGGGG - Intronic
1040872485 8:52114867-52114889 CACCACTAGAGTGCCCTGTGTGG + Intronic
1040905908 8:52469793-52469815 AACCCCTGGAGGGTCCTGAGTGG - Intergenic
1040977268 8:53207748-53207770 CACCACAGCTGGGCCCTGAGGGG - Intergenic
1041002498 8:53466164-53466186 CACCCCCTGAGGAACCTGTGGGG + Intergenic
1043982650 8:86659050-86659072 GCCCCCAGCAGGGCCCTCTGAGG - Intronic
1047186139 8:122635045-122635067 CACCCCAGGAGAACCCTGCCTGG + Intergenic
1047370517 8:124252335-124252357 CACCTCAGAAGGTCCTTGTGAGG - Intergenic
1049235565 8:141510667-141510689 CTCCCCAGAAAGGCCCTGGGGGG - Intergenic
1049385582 8:142341445-142341467 CATCCCAGGAGGGCCCTGGCAGG + Intronic
1049423253 8:142526071-142526093 CACCCCATAAGGGCCCTGGCTGG - Intronic
1049563342 8:143324434-143324456 CTCCCCAGGAGGTCCCCCTGAGG - Intronic
1049583885 8:143424223-143424245 CAGCCCTGGAGGGCCCTGAAGGG - Intronic
1049642743 8:143722727-143722749 CCCCCCAGGGTGGTCCTGTGGGG + Intergenic
1049807705 8:144548366-144548388 GACCCCAGGTGGGCCGTCTGGGG + Exonic
1057302625 9:93895623-93895645 CACCTGAGAAGGGCCCTGAGAGG + Intergenic
1057701528 9:97366368-97366390 CACTCCAGGTGGGCCCAGGGAGG + Intronic
1057873318 9:98734073-98734095 CACCCCAGCGGGGGCATGTGTGG - Exonic
1059440864 9:114306114-114306136 CACCCTAGGGGAGCCCAGTGGGG + Intronic
1059449641 9:114362391-114362413 CACCCCAGCAGGTACCTGCGAGG + Exonic
1059842182 9:118230068-118230090 GACCTTAGGAGGGCCCAGTGGGG + Intergenic
1060743367 9:126113976-126113998 CACTCCAAGAGGGCTGTGTGCGG - Intergenic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1062106142 9:134756077-134756099 CACCACAGGAGAGCCCTGCAAGG - Intronic
1062206586 9:135341032-135341054 CACCTCAGGGGTGCCCTGGGCGG + Intergenic
1062216425 9:135392108-135392130 CCTCCCAGGATGGCCCTCTGTGG - Intergenic
1062265213 9:135683760-135683782 CACCCCAGGCCAGCCCTGAGGGG + Intergenic
1062281723 9:135754874-135754896 CCCCCCAGGAGGTGCTTGTGAGG - Intronic
1062316864 9:135971693-135971715 CACCCCACGAGGGCTTTCTGGGG - Intergenic
1062498047 9:136840817-136840839 AGGCCCAGGAGGGACCTGTGAGG + Exonic
1062529933 9:136995356-136995378 GAGCCCAGGAAGGCGCTGTGGGG - Intronic
1203754962 Un_GL000218v1:117370-117392 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1203714343 Un_KI270742v1:129910-129932 CACCCCAGGGGGGTCCTGGTTGG - Intergenic
1203536863 Un_KI270743v1:48176-48198 CACCCCAGGGGGGTCCTGGTTGG + Intergenic
1186352150 X:8750932-8750954 GACCCCAGGAGGCCCCTGGGTGG + Intergenic
1187134020 X:16529489-16529511 CACCCCAGGAGGACCACGGGAGG - Intergenic
1190466396 X:50728388-50728410 GACCCCAGGAGGGCTCTGCTTGG - Intronic
1192809650 X:74536986-74537008 CAACCCGGGAGGGCCCTACGGGG + Intergenic
1197729271 X:129796002-129796024 CACCTCAGGGGGACACTGTGAGG - Intergenic
1198487661 X:137104616-137104638 CAGACCATGAGGGCCTTGTGGGG - Intergenic
1198824502 X:140685166-140685188 GACTCCAAGAGGGACCTGTGTGG - Intergenic
1199679709 X:150216195-150216217 CACCCCTGCTGGGCACTGTGTGG - Intergenic
1201168585 Y:11234979-11235001 CACCCCAGGGGGGTCCTGGCTGG - Intergenic
1202366949 Y:24172120-24172142 GCCCCCAGCAGGGCCCTCTGAGG + Intergenic
1202373457 Y:24213363-24213385 GCCCCCAGCAGGGCCCTCTGAGG - Intergenic
1202497324 Y:25456757-25456779 GCCCCCAGCAGGGCCCTCTGAGG + Intergenic
1202503833 Y:25498003-25498025 GCCCCCAGCAGGGCCCTCTGAGG - Intergenic