ID: 947712060

View in Genome Browser
Species Human (GRCh38)
Location 2:232321935-232321957
Sequence CAGGGGAAAGGCTCTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 2, 1: 0, 2: 1, 3: 30, 4: 413}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947712052_947712060 5 Left 947712052 2:232321907-232321929 CCTCAGGGCCTAGGGGCAGGGAG 0: 2
1: 0
2: 2
3: 51
4: 476
Right 947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG 0: 2
1: 0
2: 1
3: 30
4: 413
947712054_947712060 -3 Left 947712054 2:232321915-232321937 CCTAGGGGCAGGGAGCAGGCCAG 0: 1
1: 1
2: 5
3: 74
4: 613
Right 947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG 0: 2
1: 0
2: 1
3: 30
4: 413
947712042_947712060 22 Left 947712042 2:232321890-232321912 CCTGTGCCTGTGACCAGCCTCAG 0: 2
1: 0
2: 3
3: 29
4: 284
Right 947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG 0: 2
1: 0
2: 1
3: 30
4: 413
947712045_947712060 16 Left 947712045 2:232321896-232321918 CCTGTGACCAGCCTCAGGGCCTA 0: 2
1: 0
2: 0
3: 29
4: 219
Right 947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG 0: 2
1: 0
2: 1
3: 30
4: 413
947712049_947712060 9 Left 947712049 2:232321903-232321925 CCAGCCTCAGGGCCTAGGGGCAG 0: 2
1: 0
2: 3
3: 45
4: 414
Right 947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG 0: 2
1: 0
2: 1
3: 30
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947712060 Original CRISPR CAGGGGAAAGGCTCTGTCCC TGG Intronic
900179811 1:1306120-1306142 CAGGGGTGAGGCACTTTCCCAGG + Intronic
900501068 1:3004905-3004927 CAGAGAAAAGCCTCAGTCCCAGG - Intergenic
900640772 1:3687191-3687213 CAGGGGGAAGCCTGTGGCCCGGG + Intronic
900676288 1:3888652-3888674 AAGGGAAGAGGCCCTGTCCCGGG + Intergenic
901014464 1:6220073-6220095 CAGGGGTAAGCCACTGTGCCCGG + Exonic
901278623 1:8013536-8013558 CAGGGGCAAAGCTCTGTGTCGGG + Exonic
901618458 1:10560992-10561014 CAGGGGTAAGCCACTGTGCCTGG + Intronic
901742291 1:11350217-11350239 CAGGGCACAGGATCGGTCCCTGG + Intergenic
901781887 1:11599574-11599596 GAGGGGAAGGGATCTGTCCAAGG - Intergenic
902417764 1:16251533-16251555 CTGGGGAAAGGCTCCCTTCCCGG + Exonic
902544873 1:17183947-17183969 CAGGGGCTAGGCTCTGTCCATGG - Intergenic
902654829 1:17859984-17860006 CAAGGACTAGGCTCTGTCCCAGG - Intergenic
902674561 1:17999710-17999732 CACGGGACAAGCTCTGTCCTGGG - Intergenic
902838977 1:19063477-19063499 CAGCGTCCAGGCTCTGTCCCAGG - Intergenic
902880147 1:19366769-19366791 CCGGGGAATGGCTCTGCCTCTGG - Intronic
903060140 1:20663627-20663649 CAAGGGGAAGGCTGTGTCCTAGG + Intergenic
903197989 1:21707884-21707906 CAGGAGCAAGCCTCTGTGCCTGG - Intronic
903283073 1:22261366-22261388 CAGCGGAAAGGCCCCTTCCCCGG - Intergenic
903289975 1:22304311-22304333 CAGGGGCAAGCCACTGTGCCTGG - Intergenic
903742221 1:25564946-25564968 GAGGAGAAAGGCCATGTCCCAGG - Intronic
904045764 1:27607370-27607392 GAGGGGAAAGGGGCTGGCCCAGG - Intergenic
904423777 1:30410466-30410488 CTCGGGAAATGCTGTGTCCCAGG + Intergenic
904543101 1:31247276-31247298 CAGGCGTAAGCCTCTGTGCCTGG - Intergenic
904850334 1:33454578-33454600 GTGCGGAAAGGCTCTGTTCCAGG - Intergenic
905771113 1:40638615-40638637 AAGGGGAAAGCCACTGTCCCTGG + Intronic
905836107 1:41122940-41122962 CAGGTGAAAGCCACTGTGCCCGG - Intronic
905886330 1:41494044-41494066 CAGAGGAATGGCTCTGGCTCTGG - Intergenic
906269483 1:44463871-44463893 AAAAGGAAAGACTCTGTCCCTGG - Intronic
906511542 1:46412951-46412973 CCAGAGAAAGGCTCTCTCCCAGG - Intronic
906695074 1:47818120-47818142 CGGGGGACCGGCTCTGCCCCAGG + Intronic
907318315 1:53586856-53586878 CAGGGCAGAGCCTCTGTCCTAGG + Intronic
907418976 1:54333785-54333807 CAGGTGCAAGGCTCTGTGCCTGG - Intronic
907595807 1:55718820-55718842 CAGGGGAAAGGCATTGAGCCTGG + Intergenic
907653967 1:56323306-56323328 CAGGTGTGAGCCTCTGTCCCCGG + Intergenic
908520421 1:64935980-64936002 GAGGGGCAAGGGTGTGTCCCTGG - Intronic
908584579 1:65554323-65554345 CAGGGAGAATGCTGTGTCCCAGG + Intronic
909630008 1:77761087-77761109 CAGGTGTGAGGCTCTGTGCCCGG - Intergenic
915684965 1:157623782-157623804 CAGGGGACTGGCTCAGTACCAGG + Intergenic
916505109 1:165421807-165421829 CAGGGGAGAGCCACTGTGCCTGG + Intronic
917603404 1:176600794-176600816 GAGTGGAAAGACTCTGTGCCTGG - Intronic
918514124 1:185343735-185343757 CAGGTGTAAGCCTCTGTGCCTGG - Intergenic
920977522 1:210800045-210800067 CTGGGGCCAGGCTTTGTCCCAGG - Intronic
922190026 1:223310143-223310165 CTGGTTAAAGGCACTGTCCCAGG - Intronic
922513886 1:226192094-226192116 CAGGAGAATGGCTCGATCCCAGG + Intergenic
923378559 1:233391498-233391520 CAGGGTGGAGGCTCTATCCCAGG - Intergenic
923725707 1:236503471-236503493 CAAGGGCTAGTCTCTGTCCCAGG + Intergenic
923792031 1:237119760-237119782 CAGGTGAAAGGCTTTCCCCCAGG - Intronic
924002881 1:239573402-239573424 CAGGGTCAAGGCTTTGGCCCTGG - Intronic
924337005 1:242994882-242994904 CAGGGGAAGGGCTGGGTCTCAGG + Intergenic
924441360 1:244087983-244088005 CAGGAGACAGGCTAGGTCCCTGG - Intergenic
1062834764 10:628511-628533 AACAGGAAACGCTCTGTCCCTGG + Intronic
1063231690 10:4071826-4071848 CAGGGGTAAGCCACTGTGCCCGG - Intergenic
1064966893 10:21023414-21023436 CAGGGGTAAGCCACTGTGCCTGG - Intronic
1067285223 10:44903008-44903030 CAGGGGCAAGGGGCTGGCCCAGG - Intergenic
1067993570 10:51243343-51243365 AATGGGAAAAGCTCAGTCCCTGG + Intronic
1069445837 10:68472347-68472369 AAGGGGAGAGGCTGTTTCCCAGG - Intergenic
1069450587 10:68514217-68514239 CAGGTGAAAGCCACTGTGCCCGG - Intronic
1069782359 10:70964912-70964934 CAGGGGATAAGTTCTCTCCCAGG + Intergenic
1070591212 10:77802606-77802628 CAGGCGCAAGGCACTGTCCCCGG - Intronic
1070801126 10:79244904-79244926 TGGAGGAAAGGCCCTGTCCCAGG + Intronic
1071240270 10:83697383-83697405 CAAGGGAAAGTCTATGTCCCTGG - Intergenic
1071416205 10:85444343-85444365 CAGGGCAAAGGCCCTGACCCAGG + Intergenic
1072124091 10:92430241-92430263 CAGAGCGAAGACTCTGTCCCAGG + Intergenic
1074343307 10:112655716-112655738 AAGGGGTAAAGATCTGTCCCAGG + Intronic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1076090944 10:127684920-127684942 CAGAGGGAAGGATCTGTTCCAGG + Intergenic
1076762120 10:132611117-132611139 CAGGGGAGAGGCCCTGTCTGAGG + Intronic
1076762156 10:132611251-132611273 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076762170 10:132611296-132611318 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076762221 10:132611475-132611497 CATGGGAGAGGCCCTGTCCGGGG + Intronic
1076762271 10:132611610-132611632 CAGGGGAGAGGCCCTGTCAGGGG + Intronic
1076762288 10:132611655-132611677 CAGGGGAGAGGCCCTGTCAGGGG + Intronic
1076762304 10:132611700-132611722 CAGGGGAGAGGCCCTGTCCAGGG + Intronic
1076762332 10:132611790-132611812 CAGGGGAAAGGCTCCATCAGAGG + Intronic
1076762379 10:132611925-132611947 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076762394 10:132611970-132611992 CAGGGGAGAGGCCCTGTCAGAGG + Intronic
1076784124 10:132740949-132740971 CAGGTGTGAGGCACTGTCCCTGG - Intronic
1076807460 10:132866229-132866251 CACGGGACAGGCTCTGGCTCAGG + Intronic
1076919597 10:133444809-133444831 CAGGGAGAGGGCTCTGCCCCAGG - Intergenic
1077338333 11:2015274-2015296 AGGGGGAGCGGCTCTGTCCCTGG - Intergenic
1077473911 11:2777531-2777553 CAGGGAAAAGGCACATTCCCTGG + Intronic
1077522233 11:3043245-3043267 AAGGGGCAGAGCTCTGTCCCTGG + Intronic
1080068877 11:28054485-28054507 CAGGCGTAAGCCACTGTCCCTGG + Intronic
1082177482 11:49077992-49078014 CAGGTGTGAGGCTCTGTGCCTGG + Intergenic
1082892296 11:58152996-58153018 CAGGTGGCAGGCTCTGTGCCAGG - Intronic
1083199459 11:61111335-61111357 GAGGGCAAATGCCCTGTCCCGGG - Intronic
1083235712 11:61349525-61349547 CTGGGGACAGGCTCTGTTCTTGG + Exonic
1083736953 11:64686816-64686838 CAGTGGAAGGGCCCTGTGCCGGG - Intronic
1083922875 11:65789938-65789960 CAGGGGAAAGATTCTGCCCCGGG - Intronic
1084204731 11:67584804-67584826 CATGGGCAAGCCTCTGCCCCCGG + Intronic
1084325590 11:68397922-68397944 CTGGGGAGAGGCTATATCCCTGG + Intronic
1084507483 11:69577446-69577468 CAGGTGTAAGGCACTGTGCCTGG + Intergenic
1084708103 11:70827570-70827592 CAGGGGCAAGGTTCTGTTGCCGG + Intronic
1084784320 11:71433363-71433385 CAGGTGCAAGGCTGTGGCCCAGG - Intronic
1088402675 11:109438471-109438493 CAAGGGAAGGGCTCTGGCCCTGG + Intergenic
1088672644 11:112158122-112158144 CAGGGGTAAGCCACTGTGCCCGG + Intronic
1089163794 11:116459413-116459435 CAGGGGAACGGATCTGCCGCTGG + Intergenic
1089334859 11:117716226-117716248 AAAGTGAAAGGATCTGTCCCTGG + Intronic
1089456535 11:118629037-118629059 GAGGGGAATGGCTTTGTCCAAGG + Intronic
1089677877 11:120102343-120102365 CAGTGGGAAGCCTCAGTCCCTGG - Intergenic
1090218379 11:124991959-124991981 CAGGCGTAAGCCACTGTCCCCGG + Intronic
1090228344 11:125084904-125084926 CAGGGGAAAGGCACTGCCTTGGG + Intronic
1202821317 11_KI270721v1_random:70456-70478 AGGGGGAGCGGCTCTGTCCCTGG - Intergenic
1091687976 12:2577235-2577257 GAGGGGAAAGACACTGTCCTGGG - Intronic
1091698388 12:2643264-2643286 CATGGAAAGGACTCTGTCCCGGG - Intronic
1091783631 12:3229496-3229518 AAGGGGAAAGCCTCTGATCCTGG - Intronic
1092182008 12:6452437-6452459 CAGGGGAAAGGCTCAGCGGCTGG + Intronic
1092257419 12:6935163-6935185 CAGGTGTAAGCCTCTGTGCCCGG + Intronic
1093966070 12:25327621-25327643 CAGGTGTGAGGCTCTGTGCCTGG - Intergenic
1094134290 12:27107982-27108004 CAGGGGTAAGCCACTGTGCCTGG + Intergenic
1095162352 12:38933180-38933202 CAGCATAAAGGCTCTGTCTCGGG + Intergenic
1096410694 12:51375151-51375173 CAGGGGTGAGCCACTGTCCCTGG + Intronic
1096514156 12:52147152-52147174 CAGGGGACAGGCCCTGGCACAGG - Intergenic
1096850253 12:54430900-54430922 TAGGGGAAAGGCTCTGTAGGGGG + Intergenic
1097287319 12:57888272-57888294 CCCGGGGAAGGCACTGTCCCAGG + Intergenic
1098453481 12:70646257-70646279 CATGGGAAATCCTCTGTCCAAGG - Intronic
1098908932 12:76189569-76189591 CAGGTGAGAGGCACTGTGCCCGG + Intergenic
1099201185 12:79679038-79679060 CAGGTGAAAGCCACTGTGCCCGG + Intronic
1099213376 12:79821658-79821680 CAGGAGAATGGCTCAGACCCAGG + Intronic
1099435600 12:82641484-82641506 CAGGTGAAAGCCACTGTGCCTGG - Intergenic
1101479714 12:105084794-105084816 CAGCGGAGAGGCGCGGTCCCTGG - Intergenic
1102431934 12:112890534-112890556 CAGGGTCAAGGCTCAGTCCTGGG + Intronic
1103251257 12:119501923-119501945 CAGGGGAAAGGATTTGTCTGAGG - Intronic
1103285286 12:119796002-119796024 CAGGGGCAAGGCACTGTTTCAGG + Intronic
1104659025 12:130595764-130595786 CAGGGCAAACGCCCTGTGCCAGG + Intronic
1104735160 12:131131997-131132019 CTGGGTAAAGGCCCTGTCCTGGG - Intronic
1106617833 13:31346616-31346638 CAGGAGAAACTCTCTTTCCCAGG - Intergenic
1107731702 13:43355676-43355698 AAGGGGCAGGGGTCTGTCCCAGG + Intronic
1109330832 13:60927600-60927622 CAGGGGTGAGCCTCTGTGCCCGG + Intergenic
1111613800 13:90639481-90639503 CTGGTCAAAGGCTATGTCCCTGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112328315 13:98458710-98458732 AAGGGGACAGGCCCTCTCCCAGG - Intronic
1112744332 13:102509612-102509634 CATGGGAGAGGGTCTTTCCCAGG + Intergenic
1113871279 13:113561348-113561370 CATGGGTAAGGCTCTGGGCCGGG + Intergenic
1115228636 14:31133252-31133274 CAGGGAGAAGGCACTGTCACAGG - Exonic
1115571580 14:34671690-34671712 CAGGGGCAAGCCACTGTGCCTGG + Intergenic
1116352611 14:43884912-43884934 TAGGTGAAAGGCTCTGTGCTAGG - Intergenic
1117078642 14:52128870-52128892 CAGAGGGAAGGCTCTGTCTGAGG + Intergenic
1117768069 14:59103522-59103544 GGAGGGAAAGACTCTGTCCCAGG + Intergenic
1118303101 14:64632787-64632809 CTGAGGGAAGGATCTGTCCCAGG + Intergenic
1118595225 14:67430227-67430249 CAGGGTTCAAGCTCTGTCCCAGG - Intergenic
1119274566 14:73342172-73342194 CAGGCGTAAGCCACTGTCCCTGG + Intronic
1119484060 14:74976993-74977015 CAGGCAACAGGCTCTGTCTCTGG + Intergenic
1119622137 14:76139021-76139043 CAGGGAAGAGGCTCACTCCCAGG + Intergenic
1120197412 14:81500186-81500208 CAGGGGTAAGCCACTGTACCCGG + Intronic
1121170458 14:91849768-91849790 CAGGGGTAAGCCACTGTGCCTGG - Intronic
1121470944 14:94153879-94153901 CCTGCGAAAGGCTCTGTACCAGG + Intronic
1121928621 14:97951761-97951783 GAGAGGAAAGGCTTTGTCCAAGG - Intronic
1122065984 14:99174836-99174858 CCGGGGAAGGGCTCGGTGCCTGG + Exonic
1122445006 14:101761760-101761782 CAAGCGAAAGACTCAGTCCCCGG + Intergenic
1122687339 14:103515709-103515731 CAGGGGAAAGGCTTGAGCCCAGG + Intergenic
1125342603 15:38689570-38689592 AAGGGGACAAGCTCTGTCCTGGG + Intergenic
1125410466 15:39400657-39400679 CAAGGGAAAGTCTTTGTCACTGG + Intergenic
1125610798 15:40968608-40968630 CAGGGAAAAGCCACTGTGCCTGG + Intergenic
1125639023 15:41214231-41214253 CAGGTGTAAGCCACTGTCCCTGG - Intronic
1127434662 15:58945142-58945164 CAGGCGAGAGCCACTGTCCCCGG + Intronic
1128228928 15:66021583-66021605 AAGGAAAAAGGCTGTGTCCCAGG + Intronic
1128403569 15:67311937-67311959 CAGTGCAAAGGCTCTCTTCCTGG - Intronic
1128939415 15:71775616-71775638 CAGGAGAAAGGCTTGGACCCGGG + Intronic
1129117339 15:73371865-73371887 CAAGGGGAAGGCCCTGTCTCAGG + Intergenic
1129451447 15:75653364-75653386 CAGGGGAAAGTAACTGTCCAGGG + Intronic
1132268034 15:100495044-100495066 CAGGGAAAAGGCTTTTTCACTGG + Intronic
1132572879 16:651655-651677 CAAGGGAGAGGCTGTGGCCCCGG - Exonic
1133779178 16:8923864-8923886 CAGGGGAATGGCTGTTTCCCTGG - Intronic
1133812756 16:9173946-9173968 CAGGGGTAAGCCACTGTGCCTGG + Intergenic
1134266064 16:12693471-12693493 CAGGGGTGAGTCTCTGTGCCTGG + Intronic
1135167321 16:20150883-20150905 CAAGGGAAAGTCTCTGTAGCAGG - Intergenic
1135724223 16:24842309-24842331 CAGGGGTAAGCCACTGTGCCCGG + Intergenic
1135864939 16:26092448-26092470 CAGGTGAGAGGCTCTGGCTCTGG + Intronic
1137334032 16:47530427-47530449 CAGGGGAAAGCCACTGCGCCTGG + Intronic
1138458222 16:57133249-57133271 CAGGGGACTGGCTCTGTGCCGGG + Intronic
1138598513 16:58041891-58041913 CAGGGAAAAGGCTCAGGGCCAGG - Intronic
1139324459 16:66141357-66141379 GTGGGGAGAGGCTCTGTGCCTGG - Intergenic
1139391703 16:66609596-66609618 GCAGGGAAAGGCTCTGCCCCAGG - Intronic
1139538711 16:67597309-67597331 CAGGCGTAAGTCTCTGTACCTGG + Intronic
1141912610 16:87070370-87070392 CAGGAGATGGGCCCTGTCCCTGG + Intergenic
1141965529 16:87440082-87440104 CAGGTGAAAGCCGCTGTGCCCGG + Intronic
1142084469 16:88169376-88169398 CAGGGGAAGGGCTGACTCCCAGG - Intergenic
1142630500 17:1222922-1222944 CAGGTGTAAGCCACTGTCCCTGG - Intronic
1143534045 17:7525091-7525113 GAGGGGAACAGGTCTGTCCCTGG + Intergenic
1143904920 17:10200227-10200249 TAGGTGAAAGGCTCTGTGCCAGG - Intergenic
1144690207 17:17256866-17256888 CAGGGGTAAGCCACTGTGCCTGG + Intronic
1145095832 17:20025212-20025234 CTGAGGCAAGGCTCTGTCCCAGG - Intronic
1145823832 17:27861581-27861603 GAGGGGAAAGGTTCTGGCTCTGG - Intronic
1146828751 17:36047900-36047922 CAGGGCAAAGCCTCTTCCCCCGG - Intergenic
1147243556 17:39106186-39106208 AAGGGAAAAGGGTATGTCCCGGG - Intronic
1147456422 17:40541051-40541073 CAGGCCAGAGGCACTGTCCCTGG + Intergenic
1147474591 17:40698695-40698717 CAGGAGAAAGCCTCCGCCCCGGG + Intronic
1147615550 17:41825315-41825337 CAGGGCACAGGCACTGTTCCTGG - Intronic
1147879435 17:43644416-43644438 CAGGGGACACACTCTGTGCCAGG + Intronic
1148556276 17:48580709-48580731 CAGGAGAGAGGGTCTATCCCGGG + Intronic
1148758923 17:49989437-49989459 CAGGGAAAAGGCTCTGAGTCAGG + Intergenic
1149040455 17:52182186-52182208 CAAGGGAAAGACACTGTGCCGGG + Intergenic
1152359098 17:79822079-79822101 CTGGGGATAGGCGCTGGCCCTGG - Intergenic
1153539356 18:6137085-6137107 CAGAGGAAAGAGTTTGTCCCAGG - Intronic
1154226005 18:12504894-12504916 CAAGGCAAAGGCTCTGTTACAGG + Intronic
1154261356 18:12835785-12835807 CAGGTGAAAGGCCCATTCCCTGG + Intronic
1157312383 18:46561789-46561811 TAGGAGAAAGGCTCTGGACCTGG + Intronic
1157586375 18:48803969-48803991 CTGGGGACAGGCTGTGTCCTAGG + Intronic
1158505790 18:58044772-58044794 GAGGGGAAAGGGGCCGTCCCCGG + Intronic
1158843924 18:61420608-61420630 CAGGGGAGAGGTGCTGTGCCTGG + Intronic
1160168019 18:76530701-76530723 CTGGGGACAGGCTGTGTCCAGGG + Intergenic
1160682581 19:418529-418551 CAGGAGCCAGGCTCTGGCCCGGG + Intronic
1160686686 19:440042-440064 AAGGAGCAAGGCTCTGACCCAGG + Intronic
1160747165 19:717468-717490 CAGGAGCGAGGCTCTGACCCAGG - Intronic
1161007263 19:1942771-1942793 CAGAGGAAAGACTGTGTGCCAGG + Intronic
1161261793 19:3341836-3341858 GAGAGGAAGGGGTCTGTCCCAGG - Intergenic
1161280320 19:3442148-3442170 CAGGAGAAAGGGCCTGGCCCAGG - Intronic
1161325904 19:3664042-3664064 CAGGAGCAAGGCTCTGACACGGG + Intronic
1161376489 19:3941733-3941755 CAGGGGAAAGGCTTGAACCCGGG - Intronic
1161482677 19:4518621-4518643 CAGGGGAAAGGTGCTGGGCCTGG - Intergenic
1161613098 19:5254600-5254622 CAGGGGAGAGGCTGTGTCCAAGG + Intronic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161723004 19:5914085-5914107 CAGGGATCTGGCTCTGTCCCAGG + Intronic
1161811106 19:6471918-6471940 CAGGCGTAAGCCACTGTCCCCGG + Intronic
1161820886 19:6530900-6530922 GAGGGGAAAGGCTCTGGGCTGGG + Intergenic
1162194046 19:8970163-8970185 CAGGGGCAAGCCACTGTGCCTGG - Intronic
1162412730 19:10516326-10516348 CAGGCGAAAGCCACTGTGCCTGG - Intronic
1162961619 19:14131153-14131175 CAGGGGTAAGCCACTGTGCCTGG + Intronic
1163462449 19:17447398-17447420 CAGGGGAATGGATCTGGCTCAGG - Intronic
1163762139 19:19143245-19143267 CAGGGGTGAGCCACTGTCCCCGG + Intergenic
1164742616 19:30587702-30587724 CTGGGGAAAAGCTCCATCCCTGG + Intronic
1165074952 19:33275542-33275564 TAGAGGAAAGACACTGTCCCTGG + Intergenic
1165943636 19:39428446-39428468 CAGGGCCGAGGCTGTGTCCCGGG + Intergenic
1166096499 19:40542558-40542580 CAGCTGCCAGGCTCTGTCCCTGG + Intronic
1166295715 19:41888293-41888315 GGGTGGAAAAGCTCTGTCCCAGG + Intronic
1167001277 19:46746746-46746768 AAGGGGTAAGGCTCTTTCTCTGG - Exonic
1167621742 19:50564600-50564622 GAGGGCAAAGGGTCAGTCCCAGG + Intronic
926884757 2:17586633-17586655 CAGGAGAAAAGCTCTGTGCTAGG - Intronic
927318492 2:21715213-21715235 CGGGGACAATGCTCTGTCCCTGG + Intergenic
927519853 2:23692182-23692204 GTGGGGAAAGGCTATGGCCCTGG + Intronic
930642720 2:53870911-53870933 CAGGCGTAAGCCTCTGTGCCCGG + Intronic
931732409 2:65165011-65165033 GAGGTGAAAGGATCTGTCCTAGG + Intergenic
932240338 2:70151356-70151378 CAGGTGTAAGCCACTGTCCCTGG - Intronic
933768666 2:85729166-85729188 CTGGCGGGAGGCTCTGTCCCCGG + Intergenic
934011972 2:87830230-87830252 CAGGGTACAGGCTCTCTCCTGGG + Intergenic
934567298 2:95347745-95347767 CAGGGGAAAAGCTACATCCCTGG - Intronic
936465367 2:112743713-112743735 CAGGGGTAAGCCACTGTGCCTGG + Intronic
937256474 2:120559703-120559725 ATGAGGAAAGGCTCTGTCCCAGG + Intergenic
937886088 2:126900865-126900887 CAAGGGCAAGGCTGTGTCCCCGG - Intronic
937906141 2:127053788-127053810 CAGGGGAAGGGCAGTGACCCAGG + Intronic
938091864 2:128439771-128439793 GTGAGGGAAGGCTCTGTCCCCGG - Intergenic
938374687 2:130797797-130797819 CAGGAGAGAGGCCCCGTCCCTGG - Intergenic
938696223 2:133837682-133837704 CAGAGGAGAGGCCCTGTTCCTGG - Intergenic
941135592 2:161714228-161714250 CAGGTGAATGGCTCTTTCCTAGG - Intronic
943389552 2:187246804-187246826 CAGGTGTGAGCCTCTGTCCCCGG + Intergenic
944595260 2:201255353-201255375 CAGGGGTAAGCCACTGTGCCTGG + Intronic
945180777 2:207088843-207088865 CAGAGGAAATGCTCTGACTCTGG - Intronic
946442047 2:219704822-219704844 AATGGGAACAGCTCTGTCCCTGG + Intergenic
947284980 2:228504384-228504406 CAGGGGTAAGCCACTGTGCCCGG + Intergenic
947508357 2:230727690-230727712 CAGGTGTAAGCCTCTGTGCCTGG + Intronic
947712060 2:232321935-232321957 CAGGGGAAAGGCTCTGTCCCTGG + Intronic
947731299 2:232433054-232433076 CAGGGGAAAGGCTCTGTCCCTGG + Intergenic
947874352 2:233458548-233458570 CAAGGAAAGGGCTCTGGCCCAGG - Intronic
948114876 2:235487519-235487541 CAGGCGTAAGGCACTGTACCCGG - Intergenic
948309091 2:236971895-236971917 CCTGGGAACGCCTCTGTCCCTGG - Intergenic
948787283 2:240359188-240359210 CAAGGGAGAGGCTCTCCCCCTGG + Intergenic
1168861944 20:1051877-1051899 CATGGGGATGGCTCTGGCCCTGG - Intergenic
1169688805 20:8307253-8307275 CAGTTGAAAGGCTCTGTCTCTGG + Intronic
1169726220 20:8735836-8735858 CAGGGGAAATGAGTTGTCCCAGG + Intronic
1169983383 20:11412586-11412608 CAATGGTAAGTCTCTGTCCCAGG - Intergenic
1170560818 20:17556983-17557005 CAGGGCCCAGGCTCTCTCCCTGG + Intronic
1172061650 20:32190579-32190601 CAGGGGACAGGCCCAGTCGCTGG + Intergenic
1172412671 20:34737337-34737359 TAGGGGCAAGGCACTGTGCCAGG + Intronic
1172550048 20:35791988-35792010 CAGTGGAAAGGGCCTGTGCCAGG - Intronic
1173673915 20:44817468-44817490 CAGGGCATAGGCTTTGTCCCAGG - Intergenic
1174624674 20:51904181-51904203 CAGGGCAAAGGCTCTGGTGCAGG + Intergenic
1175102765 20:56591542-56591564 CAGGGCAAAGCCACTGTGCCCGG + Intergenic
1175158192 20:56988412-56988434 CAAGGGAAATGCTCTCTCCAGGG - Intergenic
1175564840 20:59965301-59965323 CAGAGTGGAGGCTCTGTCCCTGG + Intronic
1175669022 20:60885600-60885622 CAGAGCAAATGCTCTGGCCCAGG + Intergenic
1175939012 20:62529306-62529328 CACGAGGAAGACTCTGTCCCAGG - Intergenic
1177814582 21:25962059-25962081 CAGAGGAAGAGATCTGTCCCAGG + Intronic
1178765446 21:35446525-35446547 CATGGGAAAGGCTCATTCTCTGG - Intronic
1179419204 21:41222472-41222494 CAGGGGAAAGGCCCTGCCCCTGG + Intronic
1179438708 21:41379047-41379069 CAGGGGAGGGGCACTCTCCCAGG - Intronic
1179572362 21:42285218-42285240 CAGGGGACAGCCACTGTGCCTGG - Intronic
1179879084 21:44286068-44286090 CAGTGGGAAGGCGCTGTCCACGG - Exonic
1181013748 22:20056739-20056761 CAGGGGAAATGCCATTTCCCAGG - Intronic
1181318125 22:21984213-21984235 CAGGGGTGAGCCACTGTCCCGGG + Intergenic
1181422397 22:22810923-22810945 CTGTGCAAAGGCTGTGTCCCTGG + Intronic
1181741847 22:24927494-24927516 CAGGGGTAAGCCACTGTGCCTGG - Intronic
1183306901 22:37087518-37087540 CAGGGGAAATGCCCCATCCCCGG - Intronic
1183410945 22:37654830-37654852 CAGGTGTAAGCCACTGTCCCCGG - Intronic
1183492973 22:38126594-38126616 CACAGGAAGGACTCTGTCCCAGG + Intronic
1184015757 22:41784636-41784658 CAGAGGAAAAGCTTTGTCGCAGG - Exonic
1184468553 22:44683063-44683085 CTGGTGGAAGGCTCTGTCCTTGG - Intronic
1184666303 22:45990851-45990873 CAGAGGTTAGGCCCTGTCCCTGG - Intergenic
1185002277 22:48253286-48253308 CAGGTGCCAGGCACTGTCCCAGG - Intergenic
949247634 3:1943744-1943766 CAGGAGAAATTCTCTGTGCCTGG + Intergenic
949871948 3:8596577-8596599 CAGGAAAAAGGCTCAGTTCCTGG - Intergenic
950456988 3:13098622-13098644 CAGTGGAAAGGCTCTGAGCTAGG + Intergenic
953033273 3:39191506-39191528 GAGGGGAAAGGAGCTGTCCAAGG + Intronic
953442315 3:42928932-42928954 CAGGGGAAAGGCTCTGGTTTCGG - Intronic
953876834 3:46671422-46671444 AAGGGAAAAGGGTCTGCCCCAGG + Intronic
953897242 3:46812032-46812054 CAGGGGACACGATCTGTCCAGGG - Intronic
953916679 3:46924995-46925017 CAGGGGAGAGGGCCTGGCCCAGG - Intronic
954982840 3:54761712-54761734 GATGGGAAAGGCTCTGACCCAGG + Intronic
955072612 3:55584473-55584495 CAGAGGAAAGGCAGTTTCCCTGG + Intronic
958871321 3:99562358-99562380 CTAGGGAAAGGAGCTGTCCCTGG - Intergenic
960095585 3:113686564-113686586 CAGGTGGAAGGCACTGTGCCTGG + Intronic
961748818 3:129083416-129083438 CAGGGTTAAGGCCCAGTCCCTGG + Intergenic
961887033 3:130103264-130103286 CAGGGGTGGGCCTCTGTCCCTGG + Intronic
961918579 3:130402670-130402692 CTGGGGACAGGCACTGTGCCTGG + Intronic
962812383 3:138970877-138970899 CAGGGCAAAGACTCTAGCCCTGG + Intergenic
963068282 3:141281263-141281285 CATAGGGAACGCTCTGTCCCCGG - Intronic
963084226 3:141422020-141422042 CTGGGGAAGGGCTCTGCCCAAGG + Intronic
965673204 3:171168375-171168397 CCGGGCAAAGGCTCAGTCCTGGG - Intronic
967392960 3:188975104-188975126 CAGGGGTCTGGCTCTGTGCCTGG - Intronic
968311375 3:197686421-197686443 CGGAGGCAAGGCTCTGACCCCGG + Intronic
968609615 4:1551094-1551116 CAGGGGGAAGGAGCTGTCCTTGG + Intergenic
968621181 4:1604140-1604162 CCGAGGAAAGGTTCTGCCCCCGG + Intergenic
968655019 4:1774723-1774745 CAGGGCAGAGGCTGTGGCCCTGG + Intergenic
968799634 4:2733545-2733567 CTGGGGAAAGGCCCAGGCCCGGG + Intergenic
968878694 4:3287805-3287827 CATCTGAAATGCTCTGTCCCGGG - Intergenic
969286062 4:6202514-6202536 CCTGGGGAAGGATCTGTCCCAGG - Intergenic
970536873 4:17038909-17038931 CAGGGGCAATGCTCTGTCTATGG - Intergenic
971307234 4:25494134-25494156 CAGGTGAGAGGCTCTGTGCCCGG + Intergenic
972686219 4:41356241-41356263 CAGGGGAGAGCCACTGTGCCCGG - Intergenic
973004598 4:44991825-44991847 CAGGGGTAAGGATCATTCCCAGG - Intergenic
975343718 4:73270321-73270343 CCGGGGTCTGGCTCTGTCCCAGG + Intergenic
976115855 4:81725327-81725349 CAGGTTATGGGCTCTGTCCCTGG - Intronic
976388210 4:84483419-84483441 CTGGGGGCAGGCTCCGTCCCTGG - Intergenic
976772770 4:88671799-88671821 CAGGGGTAAGCCACTGTGCCTGG + Intronic
976874633 4:89837578-89837600 CAAGGGATAGGCTCTGCCCTTGG - Intronic
977577915 4:98694292-98694314 CAGGTGAAGGGCTCCGCCCCTGG + Intergenic
978074207 4:104508919-104508941 CAGGAGAAAGTGTATGTCCCAGG - Intergenic
980851480 4:138388153-138388175 CAGGGGCAAGGCCCTTTCGCAGG + Intergenic
981429328 4:144641953-144641975 CAGGGGCAAGCCACTGTGCCTGG + Intergenic
983187455 4:164716714-164716736 GAGGGTAAAGGCTCTATGCCCGG + Intergenic
984986169 4:185331686-185331708 CAGGAGAATGGCTTTGACCCGGG + Intronic
985625299 5:982486-982508 CTGGGGAAAGGCCCTGGCACAGG - Intergenic
985873383 5:2577001-2577023 CAGGGCAATGGGTCTGGCCCTGG + Intergenic
985974132 5:3401847-3401869 CAGAGGAAAGGTGCTGCCCCAGG - Intergenic
986467944 5:8045681-8045703 ATGGGGGAAGGCTCTGTTCCAGG + Intergenic
987100139 5:14583597-14583619 CAGAGGAAAGAATCTCTCCCTGG - Intronic
987335348 5:16893867-16893889 CTGGGGAGAGGCTGTGTCCTCGG - Intronic
988509596 5:31854436-31854458 CAGCCGAAAGGCTCTGACCGGGG + Intronic
990053371 5:51537606-51537628 CTGGGGAAAGGTGCTGACCCAGG - Intergenic
991130504 5:63117559-63117581 CAGGGAAAAGGCTATATCCATGG - Intergenic
991461170 5:66860887-66860909 CATGGGAAAGGCGCTGTGCATGG + Intronic
991718723 5:69476203-69476225 CAGGAGAATGGCTCAGACCCAGG + Intergenic
991719232 5:69480167-69480189 CAGGAGAATGGCTCAGACCCAGG - Intergenic
992169637 5:74089059-74089081 CAGGAGACAGGGTCTGTGCCAGG - Intergenic
993512194 5:88784747-88784769 CATGTAAAAGGCTTTGTCCCTGG + Intronic
994278691 5:97871873-97871895 CATGGGAAAGGCTCTGAGGCAGG + Intergenic
995466615 5:112456398-112456420 CAGGGGTAAGCCACTGTGCCTGG - Intergenic
995717838 5:115097543-115097565 CAGGGAATAGCCACTGTCCCTGG - Intergenic
997952724 5:138254594-138254616 CAGAGGAAAGGCTCTGGGCCAGG - Intronic
998039628 5:138944163-138944185 CAGGGCAAGGGCTCTGGCCCTGG - Intergenic
998533265 5:142904642-142904664 CTGGGGAAAGGCTCTGTGATGGG + Intronic
1001171698 5:169425387-169425409 CCTGGGAAAGGTTCTGTTCCTGG + Intergenic
1001238829 5:170052417-170052439 CAGGGGAGATGTTGTGTCCCAGG - Intronic
1001624739 5:173121955-173121977 CAGGGGAATGGCTTTAGCCCAGG - Intronic
1001784341 5:174399017-174399039 CATGGGACAGGCTCTGTACTAGG - Intergenic
1001818809 5:174693744-174693766 CAGGGGTCAGGGTCAGTCCCAGG - Intergenic
1003174430 6:3744601-3744623 CATGGGCAAGGCCCTTTCCCGGG - Intronic
1003461978 6:6337858-6337880 CAGGCGTAAGGCACTGTGCCCGG - Intergenic
1003732739 6:8844086-8844108 CAATGGAAAGGCTCTGCCACCGG - Intergenic
1003995404 6:11535906-11535928 CAGGTGCCAGGCACTGTCCCAGG + Intergenic
1004027860 6:11836762-11836784 CAGGCGCAAGGCACTGTGCCTGG + Intergenic
1005386700 6:25292512-25292534 CTGGGGGCAGGCTCTGGCCCTGG + Intronic
1005468964 6:26143143-26143165 CAGGAGAAAGGCTCTGTGGTAGG - Intergenic
1009387574 6:63104520-63104542 CAGGTATAAGCCTCTGTCCCTGG + Intergenic
1010792171 6:80077277-80077299 AATGCTAAAGGCTCTGTCCCAGG - Intergenic
1011628979 6:89306508-89306530 AAGGAGGAAGGCTTTGTCCCAGG - Intronic
1012358139 6:98341801-98341823 CAGGGGAAACTCTCTGTTCAGGG - Intergenic
1012686596 6:102258357-102258379 AAGGAGAAAGGCTCTCTCCAGGG - Intergenic
1012809912 6:103944146-103944168 GTGAGGAAAGGCTCTGTTCCAGG + Intergenic
1014079881 6:117273484-117273506 CAGGGGAAAGGGTCTGTGCGTGG + Exonic
1014216426 6:118756472-118756494 CATGGGACAAGCTCTGTCTCAGG - Intergenic
1015166507 6:130205803-130205825 CAGAGGAAGGGCTCCGTGCCTGG + Intronic
1016043539 6:139457799-139457821 CTGGGGAAAGACTGGGTCCCGGG + Intergenic
1016783339 6:147984511-147984533 AAGGTGAAAGGCTCTGTGCCCGG - Intergenic
1016797729 6:148135761-148135783 CAGGTGTAAGGCACTGTACCCGG - Intergenic
1017917924 6:158846999-158847021 CTGAGGGAAGGATCTGTCCCAGG + Intergenic
1018417019 6:163610646-163610668 GGGAGGAAAGGCTATGTCCCTGG - Intergenic
1018431060 6:163723272-163723294 CAGAGGTGAGGCTCTGTCCTGGG + Intergenic
1018538147 6:164846009-164846031 CAAGGGAGAGGCTGTGTTCCAGG + Intergenic
1019367921 7:644756-644778 CTGGGGGAAGGGTCTGGCCCTGG - Intronic
1019462334 7:1167175-1167197 CAGGGGTAAGCCACTGTGCCCGG + Intergenic
1019462344 7:1167224-1167246 CAGGGGTAAGCCACTGTGCCCGG + Intergenic
1020211875 7:6163992-6164014 CAGGGAAAAGGCTGTTTCCTAGG + Exonic
1020621719 7:10527591-10527613 CATGGGAAAAGCTTTTTCCCTGG - Intergenic
1021566566 7:22022531-22022553 CTGAGGGAAGGATCTGTCCCAGG - Intergenic
1022234083 7:28444549-28444571 CAGGGGAAAGACTCTTCCACTGG + Intronic
1026508512 7:71007360-71007382 CCTGGGGAAGGCTCTGTCCTGGG + Intergenic
1028494737 7:91450428-91450450 CAGGGGAAAGTTTCTATCCAAGG + Intergenic
1029269594 7:99369183-99369205 CAGGGGCAGGGCCCTGTCACTGG + Intronic
1029933793 7:104401059-104401081 CTGGGGATAGGCCCTGGCCCTGG + Intronic
1029933924 7:104402664-104402686 CTGGGGAGAGGCCCTGGCCCTGG - Intronic
1030996928 7:116370902-116370924 ATGGGGAAAGACTCTATCCCAGG - Intronic
1032019873 7:128401382-128401404 CTGGGGAAAGCCTCTTTCCTGGG + Intronic
1033445486 7:141418073-141418095 CATGGGAAAGGTTAAGTCCCAGG + Intronic
1034262470 7:149765432-149765454 CACGCGAAAGGCTTTGGCCCGGG + Exonic
1034269900 7:149798377-149798399 CAGGGCACAGGCTCAGTCCTGGG - Intergenic
1034474306 7:151273901-151273923 AAGGGGAACGGGGCTGTCCCTGG + Intronic
1034699356 7:153083136-153083158 CAGGGGAATGCCTCTGTCCAGGG + Intergenic
1035638874 8:1167411-1167433 CAGGGCAGAGGCTGTGTCCCCGG + Intergenic
1035731242 8:1854915-1854937 CACGGGACATGCACTGTCCCAGG + Intronic
1036761733 8:11514159-11514181 CTGGGCAAGGTCTCTGTCCCTGG + Intronic
1037816701 8:22116323-22116345 CAGGGGGAAGGCTGGGTCCCTGG + Exonic
1039823656 8:41155367-41155389 CAGGGGAGAGCCACTGTGCCCGG - Intergenic
1041252233 8:55945828-55945850 CATGGTCAGGGCTCTGTCCCTGG - Intronic
1044043985 8:87406753-87406775 CAGGGGAAAGCCACCGTGCCCGG + Intronic
1044278244 8:90326896-90326918 TAGTGGATAGGCTCTGTTCCCGG + Intergenic
1044722021 8:95160088-95160110 CAGAGGAAAGGCTCAGGGCCTGG - Intergenic
1045439367 8:102194317-102194339 CAGGGGTAAGCCACTGTGCCTGG - Intergenic
1045893021 8:107180741-107180763 CAGGGGAAAGCCACTGTGCCTGG - Intergenic
1046698520 8:117372666-117372688 GAGGGGAAAGCCTCAGTCACAGG + Intergenic
1049415549 8:142493280-142493302 CAGGGCACAGGCTCTGCCCAAGG - Intronic
1049607790 8:143537677-143537699 CAGAGGGAAGGCTTTGTGCCAGG - Intronic
1049800791 8:144516670-144516692 GAGGGGACAGGCCCTGTACCTGG + Exonic
1050382326 9:5042753-5042775 CAGGGGTGAGGCTGTGCCCCAGG + Intronic
1053048467 9:34939001-34939023 CAGGTGAAAGGCACTGCACCTGG - Intergenic
1053607168 9:39672278-39672300 CAGGAGAATGGCTCGGACCCGGG - Intergenic
1054246366 9:62670131-62670153 CAGGAGAATGGCTCGGACCCGGG + Intergenic
1054560487 9:66704664-66704686 CAGGAGAATGGCTCGGACCCGGG + Intergenic
1055184259 9:73431770-73431792 AAGGGCAAAAGCTCTATCCCTGG - Intergenic
1056811877 9:89771371-89771393 CATGGGAAAGGGTGTGTGCCAGG + Intergenic
1057197319 9:93122243-93122265 CAGAGGAGAGGCTCTGAGCCTGG + Intronic
1059119693 9:111631132-111631154 CTGGGGGATGGCTCTGTCCCGGG - Intergenic
1059129347 9:111729382-111729404 CAGGTGAAAGCCACTGTGCCCGG + Intronic
1059131432 9:111755030-111755052 CAGGGGGTAGGCAGTGTCCCAGG - Intronic
1059342927 9:113609690-113609712 CTGTGCCAAGGCTCTGTCCCTGG + Intergenic
1059356018 9:113700065-113700087 CAGGGGAAAGGGACTGCCCACGG - Intergenic
1059439606 9:114299600-114299622 CAGGGGATATGGTGTGTCCCTGG + Intronic
1060111137 9:120907137-120907159 CAGGCGAGAGCCTCTGTGCCCGG + Intronic
1060176187 9:121499237-121499259 CAGAGGAATGGCTCTTGCCCAGG - Intergenic
1060361283 9:122959859-122959881 CAAAGTAAAGCCTCTGTCCCAGG - Intronic
1060612332 9:124979001-124979023 CAGGGGAATGCCACTGTGCCTGG + Intronic
1061108379 9:128550016-128550038 GAGGGGAAGGGGTCTCTCCCAGG + Intergenic
1061367245 9:130178434-130178456 CAGGGGAAAGCCCTTTTCCCCGG + Intronic
1061959790 9:133982174-133982196 CAGGGGAAAGGCCCTGAACTGGG + Intronic
1062321798 9:135993860-135993882 CAGCGGAAAAGCGCGGTCCCGGG + Intergenic
1062477568 9:136736261-136736283 GAGGGCAATGGCTCTGTCCCGGG - Intergenic
1185683200 X:1906048-1906070 CAGGGTAAGGGCTCTGGCCAGGG + Intergenic
1189800964 X:44691602-44691624 GTGGGGAAAGGATCTGTTCCAGG + Intergenic
1190557861 X:51654660-51654682 CAGGTGTAAGCCACTGTCCCCGG + Intergenic
1191735795 X:64386764-64386786 CAGGTGAAAGCCACTGTACCTGG - Intronic
1191757819 X:64613351-64613373 CAGGGCTGAGACTCTGTCCCTGG + Intergenic
1192723826 X:73727278-73727300 GAGGGAAATGGATCTGTCCCAGG - Intergenic
1195857821 X:109349648-109349670 CAGGGGTAAGCCACTGTGCCTGG + Intergenic
1198119985 X:133582881-133582903 CGGGGGGAGGGCTCTGTCCTGGG + Intronic
1199998948 X:153046602-153046624 AGGGGAAAAGGGTCTGTCCCCGG + Intergenic
1201686974 Y:16715941-16715963 CAGGTGTAAGCCTCTGTACCTGG - Intergenic