ID: 947712074

View in Genome Browser
Species Human (GRCh38)
Location 2:232321981-232322003
Sequence CAGGGTCACCCATCTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 2, 1: 0, 2: 2, 3: 19, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947712074_947712081 7 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712081 2:232322011-232322033 CAGCTGCTGTGGTCTGGCAGAGG 0: 1
1: 0
2: 1
3: 50
4: 349
947712074_947712082 8 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712082 2:232322012-232322034 AGCTGCTGTGGTCTGGCAGAGGG 0: 1
1: 0
2: 0
3: 29
4: 252
947712074_947712084 12 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712084 2:232322016-232322038 GCTGTGGTCTGGCAGAGGGGAGG 0: 1
1: 0
2: 2
3: 35
4: 429
947712074_947712083 9 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712083 2:232322013-232322035 GCTGCTGTGGTCTGGCAGAGGGG 0: 1
1: 0
2: 3
3: 28
4: 359
947712074_947712085 15 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712085 2:232322019-232322041 GTGGTCTGGCAGAGGGGAGGAGG 0: 1
1: 0
2: 3
3: 68
4: 712
947712074_947712080 1 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712080 2:232322005-232322027 GCTCTGCAGCTGCTGTGGTCTGG 0: 1
1: 0
2: 2
3: 46
4: 301
947712074_947712079 -4 Left 947712074 2:232321981-232322003 CCAGGTTCAGATGGGTGACCCTG 0: 2
1: 0
2: 2
3: 19
4: 122
Right 947712079 2:232322000-232322022 CCTGGGCTCTGCAGCTGCTGTGG 0: 1
1: 1
2: 10
3: 94
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947712074 Original CRISPR CAGGGTCACCCATCTGAACC TGG (reversed) Intronic
900231093 1:1558272-1558294 CAGGATCACCCACCTGAGTCTGG + Intronic
901432575 1:9226029-9226051 CAGGGTCTACCTTCTGGACCAGG + Intergenic
903908191 1:26701531-26701553 CAGGGTCACACAGCTTAATCTGG - Intronic
904029209 1:27523520-27523542 CAGGGTCACACAGCAGAACCAGG + Intergenic
904376315 1:30084605-30084627 CAGGGTCACCAAGCAGAAACAGG - Intergenic
904496583 1:30890720-30890742 CAGGGTCACACAGCAGAGCCTGG + Intronic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904926888 1:34056501-34056523 CAAGGTCACACAGCTGAGCCAGG - Intronic
905234300 1:36535259-36535281 CTGGGTCACCCAGCTTAGCCTGG + Intergenic
905446178 1:38029787-38029809 CAGGGGCTGCCTTCTGAACCGGG + Intergenic
905876510 1:41435171-41435193 CAGAGTCACACAGCAGAACCAGG - Intergenic
906683328 1:47745927-47745949 CATCATCACCCAACTGAACCCGG + Intergenic
910292963 1:85616570-85616592 CAGGATCACTTATCTGAAGCCGG + Intergenic
912618748 1:111133877-111133899 CAGGGACACTCAGCTGAAGCTGG - Intronic
913972149 1:143423622-143423644 GAGGGTCACCCATCTGACTCCGG - Intergenic
914066530 1:144249235-144249257 GAGGGTCACCCATCTGACTCCGG - Intergenic
914112623 1:144717119-144717141 GAGGGTCACCCATCTGACTCCGG + Intergenic
922236608 1:223726958-223726980 CAGGGCCATCCCTCTGAAACTGG - Intronic
922881349 1:228983453-228983475 CAGGATGACCCATCTGCCCCTGG + Intergenic
1068768957 10:60798828-60798850 CTGGGTCACCCTTGTGAACAAGG - Intergenic
1070699806 10:78593457-78593479 CTGGGTCACCCATCTGTCCTTGG - Intergenic
1074100114 10:110348232-110348254 CAGGGTCACCCATCAGGGGCTGG - Intergenic
1074101141 10:110355732-110355754 CAAGGTCACCCAACTGGACTCGG - Intergenic
1075087217 10:119421767-119421789 CAGGGTCTCCCAGCTGAGCCAGG - Intronic
1076979659 11:197752-197774 CAGGGTCACTAACCTGGACCAGG - Exonic
1078172713 11:8940991-8941013 CACGGTCACTCCTCTGTACCTGG - Intergenic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1084714378 11:70864352-70864374 CAGGGTCACCTGTCCGAAGCTGG - Intronic
1085177940 11:74507128-74507150 CAGGGTCAACACTCAGAACCAGG - Intronic
1085304167 11:75475828-75475850 CTGGGTCACCAATCTGAGGCAGG - Intronic
1085899597 11:80683161-80683183 TAAAGTCACCCATCTGAAACTGG + Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089731745 11:120523645-120523667 CAGGGTCACACAGCTGAACCTGG + Intronic
1091624987 12:2115015-2115037 CAAGGTCACCCAGCTAAACCAGG + Intronic
1091797830 12:3307399-3307421 CAGGGTCTTCCATGTGATCCTGG + Intergenic
1091825355 12:3508439-3508461 CAGGGTCTGACATCTGAACGCGG + Intronic
1094278974 12:28713557-28713579 CAGTGCCACCCATCTGTACTGGG - Intergenic
1094852368 12:34388024-34388046 CAGGGACACCCAGCTTAACCTGG + Intergenic
1099162392 12:79259128-79259150 CAGTTTCACCAATTTGAACCTGG + Intronic
1100611154 12:96193383-96193405 CAGGCTCTCCCATCAGAGCCTGG + Intergenic
1101649629 12:106664167-106664189 CCAGTGCACCCATCTGAACCTGG + Intronic
1102435618 12:112920903-112920925 CAGGGTCACCCAGCTGGTCAGGG + Intronic
1103611988 12:122129620-122129642 CAGGCTCACCCACCTGGACCAGG - Exonic
1104193798 12:126510913-126510935 CATGGTCACCCTCCAGAACCTGG - Intergenic
1106196702 13:27500212-27500234 CAAGATCACCCATTTGTACCTGG + Intergenic
1114209715 14:20604538-20604560 CAGGGGCGCCCATTTGAACCTGG + Intronic
1114645053 14:24250993-24251015 CAGGGAAACCCCTCAGAACCAGG - Intronic
1118394936 14:65328055-65328077 CAGGGACACCACTCAGAACCTGG + Intergenic
1121708827 14:96021547-96021569 CATGCTCACCCTTCTCAACCAGG + Intergenic
1122371579 14:101231920-101231942 CAGGGTCACACTTCTGATTCAGG + Intergenic
1122862664 14:104589483-104589505 CAGGCACACCCAGCTGAGCCCGG + Exonic
1127674872 15:61229119-61229141 CAGGGAGACCCCGCTGAACCAGG - Intronic
1130386284 15:83415071-83415093 CAGGGACCCCCTTCTGCACCTGG - Intergenic
1130900788 15:88205666-88205688 CAGGGTCAGCCCTCTCACCCCGG + Intronic
1130997424 15:88911770-88911792 CAGAGTCACCCATCTAAGGCTGG + Intronic
1132520654 16:386405-386427 CAGGGTCTCCCATGTCTACCAGG - Intronic
1133035924 16:3034246-3034268 CAGGGTCACACAGCTGGACGAGG + Intronic
1133040322 16:3057136-3057158 CAGGGTCGCCCACCGGACCCTGG - Exonic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1139375588 16:66494519-66494541 CAGGGTCACACAACTGAACTGGG - Intronic
1140231951 16:73124629-73124651 CAGGGTCACACATCTGTATTAGG + Intergenic
1141846469 16:86612505-86612527 CAAGGTCACCCAGCTGCTCCAGG - Intergenic
1142500699 17:331400-331422 CAGGGCCACCCCTGTGAACGTGG - Intronic
1143513282 17:7407271-7407293 CAGGATCACGCATCTGTCCCTGG + Intronic
1144089002 17:11836517-11836539 CCGGGTCACACCTCTGATCCTGG - Intronic
1144711542 17:17404554-17404576 CAGTGCCACCCAGCTGAACCTGG - Intergenic
1146178961 17:30685157-30685179 CAGGGTGACCCTTCTGAAGGGGG + Intergenic
1148443456 17:47723997-47724019 CAGGGTCATGCATGGGAACCTGG + Intergenic
1148906421 17:50915230-50915252 CAGGGTCACCCTTCTGGGCTGGG + Intergenic
1155159672 18:23185445-23185467 CAGGAACACACAGCTGAACCAGG - Intronic
1156903580 18:42328958-42328980 CACAGTCACCCCTCTGAAACTGG - Intergenic
1157256073 18:46140862-46140884 CTGGGTCAGCCATCTGGACATGG + Intergenic
1157367581 18:47079937-47079959 CAGGGTGACACACCTGAACCCGG - Intronic
1158222421 18:55163305-55163327 CAGGGTCACCCTTGTCACCCAGG - Intergenic
1161468178 19:4443656-4443678 TAGGGTCACCTCCCTGAACCCGG + Intronic
1162979652 19:14230397-14230419 CAGGGTGACCCTTCTGAAGGGGG - Intergenic
1164902383 19:31939055-31939077 CAGGCTCCACCATCTGTACCAGG + Intergenic
1164941186 19:32253203-32253225 CAGGGTCACCCACAGGGACCTGG + Intergenic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
1167081693 19:47280453-47280475 CATGGTCTCTCACCTGAACCAGG - Intergenic
925763233 2:7206821-7206843 CATGTTCACCCATCAGCACCAGG + Intergenic
931190801 2:59998352-59998374 CAGGTTCACACAACTGAGCCTGG - Intergenic
934176846 2:89584559-89584581 GAGGGTCACCCATCTGACTCCGG - Intergenic
934287153 2:91658919-91658941 GAGGGTCACCCATCTGACTCCGG - Intergenic
937871420 2:126788998-126789020 CAGAATCAACCATCTGACCCAGG + Intergenic
938240554 2:129739426-129739448 CAGGGTTGTCCATCAGAACCTGG - Intergenic
941847272 2:170145747-170145769 CAGTGTCACCCATCCATACCAGG - Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
948171463 2:235906669-235906691 CAGGCTCACCCACCTGACCATGG + Intronic
948351932 2:237347850-237347872 CAGGGTAACCCAGGTGAACCTGG - Exonic
1173374906 20:42474561-42474583 CAGGGTCACCCATTTGATTTGGG - Intronic
1173546310 20:43900916-43900938 CAGGGTCACTCCTGTGAAGCCGG - Intergenic
1175165799 20:57043592-57043614 CAGGGTCACACAGTAGAACCTGG - Intergenic
1175721326 20:61289318-61289340 CAGAGTCCCACATCTGAGCCAGG + Intronic
1181166446 22:20985888-20985910 CGGGGCCACCCACCTGCACCAGG - Exonic
1183034141 22:35128091-35128113 CAGAGCCACCCACCAGAACCAGG + Intergenic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
960125421 3:113993135-113993157 CTGGGTCACCCCTGTGACCCAGG + Intronic
967360225 3:188622199-188622221 CAGTGTCACTCATCTTAACCTGG + Intronic
968593539 4:1471409-1471431 CAGCGTCACCCATCACACCCCGG + Intergenic
974257214 4:59474258-59474280 CAGGGGCACCCCTCTGATGCAGG - Intergenic
975174640 4:71273799-71273821 CAAGGGCATGCATCTGAACCAGG - Intronic
982118805 4:152119397-152119419 CAGGGTCACACAGCAGAAACTGG + Intergenic
985538722 5:478138-478160 CAGCGGCACCCACCTGACCCCGG - Intronic
989765363 5:45076357-45076379 CAGTGTCACTCTTCTCAACCTGG + Intergenic
995565934 5:113433331-113433353 CAGGGTCACGCAACTGCCCCGGG + Exonic
998065761 5:139157020-139157042 CAGGGTCACCCATCAGATAGTGG - Intronic
998948105 5:147362889-147362911 CAGGGTCTCCCATGTGGCCCAGG - Intronic
999279045 5:150352725-150352747 CAAGGTCACACAGCTGAGCCAGG + Intergenic
999596378 5:153209874-153209896 CAGGAACACCCATCTCAAGCAGG + Intergenic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1002078935 5:176726482-176726504 CAGGGTCACTCCTCTGAGCAGGG - Intergenic
1005117122 6:22351342-22351364 CATGGTCACCCATCTGAGGAGGG + Intergenic
1010090823 6:71979392-71979414 CAGGGTCACCCAGCAGGACAGGG + Intronic
1012889812 6:104885498-104885520 TAGGGTCTCCCATCTGTTCCGGG - Intergenic
1012982204 6:105842750-105842772 CAGGGTCTCCCATCTCATCGGGG - Intergenic
1013290605 6:108716005-108716027 CAGGCTCACGCATCTGACACTGG + Intergenic
1013731975 6:113178746-113178768 CAAGGTCACCAATATCAACCAGG + Intergenic
1014272115 6:119348016-119348038 AAGGGCCACACAGCTGAACCCGG + Intronic
1016635464 6:146284169-146284191 CATAGTCACACATCTGATCCAGG + Intronic
1018447386 6:163870115-163870137 CAGGGTGACCTATCTGACCATGG - Intergenic
1019094080 6:169564714-169564736 CAGGCTCACCCATCTGCCCTGGG + Intronic
1019479586 7:1260327-1260349 CAGGCTCACCCATCCGGCCCAGG + Intergenic
1021459295 7:20867486-20867508 AAGGGTCTCCCATCTGAAAATGG - Intergenic
1021683320 7:23156736-23156758 CAGGGTAAACCTTCTGAACCTGG - Intronic
1023563923 7:41504858-41504880 CAGGGGCACCGATCTGCACGGGG - Intergenic
1023742330 7:43292011-43292033 CAGGGTCACCCTTCTCTTCCTGG + Intronic
1033358214 7:140618138-140618160 CAGGGTCACCTCTCTGATCAAGG + Intronic
1035227336 7:157440981-157441003 CAGGGCCACCCACCTGTCCCGGG - Intergenic
1035707144 8:1685083-1685105 CAAAGTCACACATCTGACCCCGG - Intronic
1039081883 8:33741560-33741582 CAGGGGCACAGAGCTGAACCAGG + Intergenic
1041751038 8:61261184-61261206 AAGGGTCATCCCTCTGGACCAGG - Intronic
1050332072 9:4555672-4555694 CAGGGTTATCCATTAGAACCTGG - Intronic
1051150709 9:14075780-14075802 CCTGGTCACCTACCTGAACCAGG + Intergenic
1061165657 9:128920795-128920817 CAGCCTAACCCCTCTGAACCAGG + Intergenic
1061712555 9:132498147-132498169 CACTGCCACCCATCTGCACCTGG - Intronic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1185611774 X:1397466-1397488 CAGGGTCACCCCCCTGAAAAGGG + Intergenic
1192237533 X:69305589-69305611 CCGGGTCACGCAGCTGAGCCCGG + Intergenic
1196995043 X:121373456-121373478 CAGGCTCAACCCTATGAACCAGG - Intergenic
1198376932 X:136049758-136049780 AAGGGTCAGCCATGTGAAGCAGG + Intergenic
1201567199 Y:15378312-15378334 CAAGGACACCCATCTGAACCAGG + Intergenic