ID: 947715720

View in Genome Browser
Species Human (GRCh38)
Location 2:232338017-232338039
Sequence TCCTGGAGCCAAGTATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 169}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947715712_947715720 5 Left 947715712 2:232337989-232338011 CCCATCTGTTCCTGTCCCCAGAA 0: 3
1: 0
2: 2
3: 30
4: 314
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715708_947715720 23 Left 947715708 2:232337971-232337993 CCCAGAGGCCACGGTCACCCCAT 0: 3
1: 0
2: 0
3: 7
4: 104
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715710_947715720 15 Left 947715710 2:232337979-232338001 CCACGGTCACCCCATCTGTTCCT 0: 3
1: 0
2: 1
3: 28
4: 224
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715716_947715720 -10 Left 947715716 2:232338004-232338026 CCCCAGAACCTTCTCCTGGAGCC 0: 3
1: 0
2: 4
3: 42
4: 360
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715713_947715720 4 Left 947715713 2:232337990-232338012 CCATCTGTTCCTGTCCCCAGAAC 0: 3
1: 0
2: 1
3: 39
4: 380
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715709_947715720 22 Left 947715709 2:232337972-232337994 CCAGAGGCCACGGTCACCCCATC 0: 3
1: 0
2: 0
3: 17
4: 167
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715714_947715720 -5 Left 947715714 2:232337999-232338021 CCTGTCCCCAGAACCTTCTCCTG 0: 3
1: 0
2: 3
3: 51
4: 413
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169
947715711_947715720 6 Left 947715711 2:232337988-232338010 CCCCATCTGTTCCTGTCCCCAGA 0: 3
1: 0
2: 1
3: 49
4: 459
Right 947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG 0: 3
1: 0
2: 0
3: 5
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947715720 Original CRISPR TCCTGGAGCCAAGTATCTGC AGG Intronic
906762264 1:48386874-48386896 TCCTGGAGCCCAGTGGCAGCAGG + Intronic
913991318 1:143614958-143614980 TCCTGGAGCCAGATATCAGGTGG + Intergenic
916064331 1:161123914-161123936 TCTTGTAGACAAGTATCTGGAGG - Exonic
916192158 1:162190233-162190255 TGGCGGAGCCAAGTATCTGAAGG - Intronic
921066954 1:211630287-211630309 GCCTGGAGCCCTCTATCTGCAGG - Intergenic
921817383 1:219579251-219579273 TCCTACAGCCAGGTATGTGCTGG + Intergenic
922160776 1:223078036-223078058 TCCTGGACCCAGAGATCTGCCGG - Intergenic
923963440 1:239108566-239108588 ACCAGCAGTCAAGTATCTGCTGG + Intergenic
1063393943 10:5669199-5669221 CCCTGGAGCCCAGAATCTCCAGG - Intergenic
1063648530 10:7909894-7909916 TCGTGGAGCTGGGTATCTGCAGG - Intronic
1067196462 10:44123596-44123618 CCCAGGAGCCAAATCTCTGCAGG + Intergenic
1068474959 10:57513270-57513292 TCTTGGAGTCAAAAATCTGCTGG - Intergenic
1070678595 10:78433223-78433245 TCCTGGTGCAAAGTTTCTTCAGG + Intergenic
1071317644 10:84418329-84418351 CTCTAGAGCCAAGTAACTGCTGG + Intronic
1072280258 10:93859455-93859477 TTCTGGAGCCAACTATCTGATGG - Intergenic
1075315241 10:121447926-121447948 TCCTGGGGCCAAGCAGCTCCAGG - Intergenic
1078722326 11:13896574-13896596 TCCTGGAGCCTAGAGTCTGGTGG + Intergenic
1081607564 11:44536955-44536977 GCCTGGAGCTAATTAGCTGCTGG + Intergenic
1084009350 11:66338957-66338979 TCCTGGAACCAAGTCTATGGAGG + Intronic
1084734782 11:71097613-71097635 CCCTGGAGCCAACAGTCTGCTGG - Intronic
1085854417 11:80160262-80160284 TCCTGGATGAAGGTATCTGCAGG + Intergenic
1086921868 11:92596468-92596490 GCCTGGAGCACTGTATCTGCAGG - Intronic
1092104371 12:5910997-5911019 TGCTGGACCCCAGCATCTGCGGG + Intronic
1092767640 12:11867921-11867943 TTCTGGAGCCAGGTGTGTGCCGG + Intronic
1094822468 12:34237195-34237217 TCCTAGATCTAACTATCTGCAGG - Intergenic
1096257793 12:50073548-50073570 TCCTGGTGCCAGGGATTTGCAGG - Intronic
1097696244 12:62777422-62777444 TCCATGAGCCAGGCATCTGCTGG - Intronic
1103972378 12:124680153-124680175 TCCCGGAGCAAAGGAGCTGCAGG + Intergenic
1104713762 12:131003743-131003765 TCTTGCAGCGAAGTATCAGCAGG - Intronic
1105278702 13:18950874-18950896 TCCTCAAGCCAAGTCACTGCTGG + Intergenic
1108088281 13:46818436-46818458 TCCTGGCTGCAAGTCTCTGCAGG + Intergenic
1109865722 13:68260728-68260750 TCATGTAGCCCGGTATCTGCTGG + Intergenic
1111518084 13:89361823-89361845 TCCTTGATCCTAGTATCTACAGG + Intergenic
1111924012 13:94443558-94443580 TCCTGAGGCCAGGCATCTGCAGG + Exonic
1114889995 14:26908054-26908076 TCCTGGAACCAATTATCTCCAGG - Intergenic
1115218259 14:31033972-31033994 GCCTGGAGCCAAGTCCCTCCTGG + Intronic
1115491213 14:33960097-33960119 ACCTAGAGATAAGTATCTGCAGG - Intronic
1116891074 14:50268943-50268965 TTCTGGAGACATGTACCTGCAGG + Intronic
1122249407 14:100427523-100427545 TCCTGGTGCCGAGTAGGTGCGGG + Intronic
1123222993 14:106873828-106873850 GCCTGGAGCCAATTATATTCTGG + Intergenic
1123903080 15:24895796-24895818 TCCTGGAGCAAAGGATATTCAGG - Intronic
1127632555 15:60840512-60840534 TCCCAGAGCCAAGCCTCTGCTGG - Intronic
1129651383 15:77493119-77493141 TCATGGAGCCTAGTATCTAGTGG + Intergenic
1129667008 15:77584897-77584919 TCCTTGTCCCAAGCATCTGCCGG - Intergenic
1130005308 15:80090806-80090828 TCTAGGAGCCATGTATCTTCAGG + Intronic
1130371109 15:83285501-83285523 TCCTGGAGCCCAGGAGCTGACGG + Intergenic
1130386677 15:83418098-83418120 TGCTTCAGCCAAGTCTCTGCTGG - Intergenic
1131692876 15:94845289-94845311 TCCTGGAGCCTATTGTTTGCCGG + Intergenic
1135957523 16:26968318-26968340 AATGGGAGCCAAGTATCTGCAGG + Intergenic
1139492343 16:67293029-67293051 TCCTGGAGCAAACTTTCTGATGG + Intronic
1141389725 16:83654548-83654570 TCCTGGGGCTAACAATCTGCAGG - Intronic
1141739516 16:85881596-85881618 TGCTCGAACCAAGCATCTGCAGG + Intergenic
1142535716 17:616548-616570 GCCTGGAGCCCAGTGTCTCCTGG - Intronic
1142976331 17:3646884-3646906 TCCTGGGGCTGACTATCTGCGGG - Intronic
1143909344 17:10234902-10234924 GCCTGGAGCAAAGCAGCTGCTGG + Intergenic
1144424205 17:15126006-15126028 TCCTGAAGCCAAGCAAATGCCGG + Intergenic
1146367791 17:32242777-32242799 TCTTTGAGCCAAGTCTGTGCTGG - Intronic
1146431824 17:32804042-32804064 TCCTGGAACCAACCCTCTGCTGG - Intronic
1147419494 17:40315264-40315286 TCCTGGAGTCAAGCAACTCCTGG + Intronic
1147955807 17:44133740-44133762 TCTAGGAGCCATGTTTCTGCTGG - Intergenic
1149607622 17:57936052-57936074 TCCTGGAGCCAAGCAGCATCAGG + Intronic
1149642775 17:58214883-58214905 ACATGGAGCCAAGTACCTGAAGG + Intronic
1151715119 17:75827398-75827420 GCCTGGAGCCAAGAACCTTCTGG - Exonic
1153983707 18:10334407-10334429 TCTTGCAGCCAGGTAGCTGCTGG - Intergenic
1156457685 18:37303902-37303924 TCCTGGAGACAAGTCCCTGGGGG + Intronic
1156462983 18:37332098-37332120 ACCTGGTGCCAAGGTTCTGCTGG - Intronic
1156482946 18:37447600-37447622 TCCAGCAGCCAAGGATGTGCTGG - Intronic
1157193473 18:45600522-45600544 TCCTGGTGCCAAGTGTATCCTGG - Intronic
1160924878 19:1539207-1539229 TCCTGGGGCCACCCATCTGCAGG + Intergenic
1161718637 19:5891566-5891588 TCTTGGAGCCTTGTCTCTGCTGG + Exonic
1162003537 19:7763445-7763467 TCTTGTGGCCATGTATCTGCTGG - Exonic
1163161465 19:15467121-15467143 TCCAGGAGCCGAGTACCAGCTGG + Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167786878 19:51644505-51644527 TGCTGGAGCCAAGTAGGTCCCGG + Intronic
929091043 2:38217645-38217667 TGCGGGAGCCCAGTGTCTGCTGG - Intergenic
929146675 2:38712603-38712625 TCCTAGATCTAACTATCTGCGGG - Intronic
930026524 2:47032392-47032414 TCCTGGAGAGCAGTGTCTGCAGG + Intronic
930234612 2:48876770-48876792 TCCTGGAGCTTTGCATCTGCAGG - Intergenic
934047470 2:88184811-88184833 TACTGCAGTCAAGTATATGCAGG + Intronic
934697920 2:96413577-96413599 TTCTGGACCCATGTGTCTGCTGG - Intergenic
936528632 2:113259443-113259465 TCAAGGAGCCAGGTGTCTGCGGG - Intronic
939893023 2:147759899-147759921 TCCTGTAGCCAAGACTCTGAAGG + Intergenic
940204811 2:151191173-151191195 TCCTGAAACCAATTTTCTGCTGG - Intergenic
941394408 2:164956270-164956292 TCCTGGATTTCAGTATCTGCAGG - Intergenic
947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG + Intronic
947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG + Intergenic
947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG + Intergenic
947845757 2:233242405-233242427 TCCTGGAGCCCCATCTCTGCAGG + Intronic
1169595439 20:7193205-7193227 TCCTAGAGTCAATTATCAGCAGG - Intergenic
1170781283 20:19427729-19427751 TCCTGGAAAAAAGTATTTGCTGG + Intronic
1173012643 20:39196145-39196167 TCCTGGAGCCAGTTATATCCAGG + Intergenic
1173423230 20:42921499-42921521 TGCTGGAGCCCAGTAACTGGAGG + Intronic
1174064139 20:47852609-47852631 TCCTGTGGCCATGTATGTGCTGG + Intergenic
1175954487 20:62602103-62602125 TTCTGGAACCAGGTATGTGCTGG + Intergenic
1176873003 21:14099124-14099146 TCCTAGATCTAACTATCTGCAGG - Intergenic
1178242934 21:30923376-30923398 TCCAAGATCAAAGTATCTGCAGG + Intergenic
1179139800 21:38714866-38714888 TACTGGAGCAAAGTCTCTCCGGG + Intergenic
1182427515 22:30282781-30282803 GCCTGGTGCCCAGCATCTGCAGG - Intergenic
1182844202 22:33417242-33417264 TCCAGGCACCTAGTATCTGCTGG + Intronic
1183149427 22:36026451-36026473 TCCTGGGGCCTATTATCTGTTGG - Intronic
1184449673 22:44575593-44575615 TCCTGGAGCCAATGTGCTGCTGG + Intergenic
949516368 3:4810850-4810872 TCCTGCAGCCCAGTGTCTGGTGG - Intronic
952758381 3:36892003-36892025 TCCTGGCACCTAGTAGCTGCAGG - Intronic
954794886 3:53156511-53156533 GCCTGGAGCCAGGTGGCTGCCGG + Intronic
954867009 3:53738196-53738218 TCCTGGAGGCACAGATCTGCAGG - Intronic
956797945 3:72732960-72732982 CCTTGGTGCCAAGTATCAGCAGG - Intergenic
957309108 3:78496676-78496698 TCCTGCAGGCAAGTATCTGAGGG + Intergenic
962993807 3:140605271-140605293 TCCTGGCCCCAAGTAGCTCCTGG + Intergenic
963063714 3:141245669-141245691 TCCTTGTGCCAATTCTCTGCAGG - Intronic
963938243 3:151076208-151076230 GCCTGGAGCCAAGAATATTCAGG - Intergenic
964331789 3:155610936-155610958 TCCACCAACCAAGTATCTGCTGG + Intronic
970971903 4:21994644-21994666 TCCAGAAGCCAAGTAGATGCCGG - Intergenic
974987620 4:69048675-69048697 GACTGGAGCCAAGTAAGTGCTGG - Intronic
975790458 4:77944172-77944194 GCCTGGAGCCTGGTAACTGCTGG - Intronic
976670456 4:87646489-87646511 TCCTGGCTCAAGGTATCTGCTGG + Intergenic
977556968 4:98496601-98496623 TCCTGCAATCAAGTAGCTGCTGG + Intronic
979517252 4:121623782-121623804 TCATTGAGCCAATTATCTGAAGG + Intergenic
980759232 4:137207134-137207156 TGCTCAAGCCAAATATCTGCAGG + Intergenic
981426998 4:144615017-144615039 ACCAGTAGCCAAGAATCTGCTGG - Intergenic
981745010 4:148044459-148044481 TCCTGCAGCCAGGGAGCTGCTGG + Intronic
982127978 4:152200629-152200651 TTTTGGTGCCAACTATCTGCCGG - Intergenic
982588482 4:157273256-157273278 TCCTGGAGTCAACTCCCTGCAGG + Intronic
983335144 4:166382120-166382142 TCCTGGATTTCAGTATCTGCAGG + Intergenic
984701109 4:182819391-182819413 GCCTGGAGCCCAGCTTCTGCGGG + Intergenic
984721136 4:182974221-182974243 ACCTGGAGCCAAGTAATGGCGGG + Intergenic
986872019 5:12059653-12059675 TCTTGGAGCCTACTATCTGGGGG + Intergenic
987155693 5:15087726-15087748 TTCTGGAGCCCATTATCTGGGGG + Intergenic
989721374 5:44532598-44532620 TCCTGGACTCATGTACCTGCCGG - Intergenic
994075736 5:95647161-95647183 TCCAGGAGGCGAGTATCTCCAGG - Exonic
996406876 5:123114151-123114173 TCATGGAGTCAAGGATCTGAAGG + Intronic
997876958 5:137558125-137558147 ACCTGGTGCCCAGTGTCTGCTGG - Intronic
1001577437 5:172773338-172773360 CCCTAGAGCCAGGTGTCTGCTGG + Intergenic
1002640144 5:180626865-180626887 TTCTGTAGCCAGGAATCTGCAGG + Intronic
1002643515 5:180641608-180641630 TCCTGGGGCCAGGCCTCTGCAGG + Intronic
1005822153 6:29607056-29607078 CCCAGGAGCCAAGGATCTGGGGG + Intronic
1007068884 6:39020183-39020205 TACTGGAGCCAATTATGTCCTGG + Intronic
1015994826 6:138987471-138987493 TCCTGGAGGCCAGTGACTGCAGG + Intronic
1017313719 6:153003481-153003503 TCCTGGAGGCAGATATCTGAAGG - Intergenic
1017339454 6:153303845-153303867 TCATGCAGCCAAATATGTGCTGG - Intergenic
1020378484 7:7514999-7515021 TCATGGAGCCAGGAGTCTGCAGG - Intronic
1022137411 7:27462099-27462121 TCTTGTAGACAAGGATCTGCTGG + Intergenic
1026834350 7:73628153-73628175 TCTTGGCTCCAAGTCTCTGCTGG + Intergenic
1028492936 7:91433370-91433392 ACCTGCAGACAAGTTTCTGCAGG - Intergenic
1031476538 7:122229846-122229868 TCTTGGAGTCAAGAATATGCAGG + Intergenic
1032388982 7:131543652-131543674 ACCTGGAGCCAGGTATATGTGGG - Intronic
1036518506 8:9468567-9468589 TCCTTGAGCATTGTATCTGCTGG - Intergenic
1036518796 8:9471129-9471151 TCTTGGAGCATTGTATCTGCAGG - Intergenic
1037504246 8:19514966-19514988 ACCTGGAGCTAGGTATCTGTGGG - Intronic
1037585765 8:20275022-20275044 TCCTGGAGGGAAGTCTCTGAAGG + Intronic
1037736561 8:21571652-21571674 TCCTGGAGCCATGTATCTCATGG - Intergenic
1038263619 8:26019533-26019555 TCCTGGGGCCAATGATCTGTTGG - Intronic
1038936616 8:32259027-32259049 ACCCGGAGTCAAGTATTTGCAGG - Intronic
1044829107 8:96228425-96228447 TCCTTGAGTGAAGTACCTGCTGG - Intronic
1046104080 8:109645476-109645498 TCCTGGAGCCGGGCAGCTGCAGG - Exonic
1046764259 8:118052857-118052879 TCCTGGAGCCATGTACCTTGGGG - Intronic
1047898658 8:129396180-129396202 GCCTGTAGCCATGTAACTGCTGG - Intergenic
1049402433 8:142434515-142434537 TGTTAGAGCCAAGTTTCTGCTGG + Intergenic
1050550509 9:6744913-6744935 TGCTGGAGGCATGTTTCTGCAGG - Intronic
1055836265 9:80446551-80446573 TCCTGGAGGAAAATATCTCCAGG - Intergenic
1056594921 9:87999692-87999714 TCCTTCAGCCAAGGAACTGCAGG - Intergenic
1057968638 9:99530655-99530677 TCCTGGAGCCCCTGATCTGCAGG - Intergenic
1059158701 9:112013274-112013296 TGCTGGAGCCCAGGAGCTGCAGG - Intergenic
1059420263 9:114186235-114186257 TCCTGGATCCAACTCTGTGCTGG - Intronic
1061996448 9:134188616-134188638 GCCTGGAGCCACGTGTCTGCTGG - Intergenic
1186434861 X:9533902-9533924 TCCTGGAGCAAGGTCTCTCCAGG - Intronic
1190148867 X:47923954-47923976 GCCTGCAGCCAAGCATCTGGTGG - Intronic
1190429428 X:50365122-50365144 TCCAGGAGCTAATTCTCTGCAGG - Intergenic
1191101534 X:56734660-56734682 TCCTTGAGTGAAGTACCTGCTGG - Intergenic
1195647359 X:107247343-107247365 TCCAGAAGCCAAGTAGATGCTGG + Intergenic
1195674840 X:107500147-107500169 TCATGGGGCCAAGTGTCAGCTGG - Intergenic
1196725395 X:118890602-118890624 GCCTGAAGCCAAATAGCTGCTGG + Intergenic
1198384173 X:136112450-136112472 TCCTGGAACCAATTATCTTGGGG - Intergenic
1199440333 X:147860685-147860707 TCTTGCAAGCAAGTATCTGCTGG + Intergenic
1199717352 X:150516042-150516064 TCCTGGAGCCCACACTCTGCTGG + Intergenic
1200700129 Y:6395045-6395067 TCCTAGAGACAAGTTCCTGCAGG - Intergenic
1200753590 Y:6969238-6969260 TCCTGGAGCAAGGTCTCTCCAGG - Intronic
1201033982 Y:9769653-9769675 TCCTAGAGACAAGTTCCTGCAGG + Intergenic